Description :
From Genome Similarity Track
Location :
Scaffold_3521:792- 2138
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3521-snap-gene-0.1Protein kinase

Sequence
1346 bases(100 bases per row)
CGACTCTCGGGGAACTCGGCCTCCCAAATCGTGCATTCGTGCTCTGCTCACCAAGGCTCCAACGTCCTACGTCCGTGCAACGTCCAACGTCCAACGTTCA
GACGCCACCGACGCCAACACCCAACACTTCCTCCTCGGGGCGAGCGAGCAACAAAACGCAGAGTTTAATTCGTTGGCGACCGCACCCCCCACGCGTACCA
ACAAGTCCCTCGGCATTTTGTTGGTGTCGGTACGAGTCTCCTTCTCTCGGTTAATTTCGGTTCCCCAACGTTGGTAAAATGGACGCCTACGAGTCGGTGC
GCATTATCGGCAAGGGTTCGTTCGGCGTCGTGACGCAGATCCGCCGCAAGTCGGACGGCAAGAACCTCGTGTGGAAGGAGGTCAACTATGGCGCCATGAG
CGAGAAGGAGAAGCAGCTCATTGTGAGCGAGGTCAACATCCTGCGCGAGCTGCGCCACCCGCACATTGTGCGGTACCTCGACCGTGTGATCGACAAGGCC
GCGACCAAGATCTACATCGTCATGGAGTACTGCGAAGGCGGCGATCTGAGCCAGTACATCAAGCGCAAGAAGCGCGAAGGCTCGTACATTGAGGAAAACT
TCATCTGGCACATCTTCACGCACGTGTTTCTCGCGCTCAAGGACTGCCATCGCCACCGCGAGGGCAACGTGATCCGCCCGATTCTCCACCGCGACATCAA
GCCCGGCAACATTTTCCTCGACGCCAACGTACGTTTGTTTCCCTAGGGGGCTTGACACCGTCATGGGTTGATACTGAAAGTGTTAGCTGGTACTATTCAG
AACAATGCGAAGTTGGGCGATTTCGGGCTCGCCAAGGAGCTGAGCAGCGAGTCGCGGTTCGCGCAGACCAACGTTGGCACGCCCTACTACATGAGTCCCG
AGATGGTCAACGAGATGACGTACGACGAGCGCTCGGACATTTGGGCGCTGGGCTGTCTGCTCTACGAGATGGCGACGCTCGCGTACGTTGGCGTTGGATG
TACTAATTTGTGGCATGGCGACTGACAAAACGTGTCTATGTGGAACCACAGTCCGCCGTTCGATGCGACCAACCAGTTGGCGCTCGCCAAGAAGATCAAT
GCCGGCAAGTTTGCGCGCATCCCGTCGCAGTACTCGGAGGGGCTCTTCCAGGTGATCCGCTGGATGCTCCACCGCCAGCGGTCGCGCCGTCCGCGTATCG
AAGACCTCGAGCGCGTGCCGCAGTTGCAGCAGCGATTACGCGCGTACGCGGCGGCCAACAGCGCCAACCCGGAGGCGCAGCAGCGTGCAACCTATGACCA
GAAGATGAAAGAGCTGCTGGCCATTGAAGAAGACTTGCGACGACAA