Description :
From Genome Similarity Track
Location :
Scaffold_2825:792- 1800
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2825-snap-gene-0.1Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_2825-snap-gene-0.0Peptidase
Pytir_DAOMBR486maker-pir_contig_2825-snap-gene-0.2Peptidase

Sequence
1008 bases(100 bases per row)
GAACGCCCACCACGCAGACTCTTGCGAGAATCCGCTCAGGTTCCTCGCTTGGAACATCGCAGGAACGCTCTACTGCGCACATGAGAACGGCAAAAACACG
GTCATGCTCGGCAAGTACGGACCAAACCAGAAGATACCTCCTAGAGCATCCGACAGATCTCCACGCGTTTGCAGCACGACGCTGCTCCAAATCGGTCACT
GCAAACTGAAAGTGGTCGCGTCTTGGCTTTTGAGAACGTTGATCGCGTCTTCGATCCCTACATGAGTGATGGTGTTCACTCTGATAGTAAACTGGTCTCT
GCCACCAGAGGTTCTGCTACTCTTGCAGCGCAGACTCAGATCTGCCGCAGAGACGCCAGTCCGACCAAGCGCTTCCCACATTCGACATGCCGATGCCCTC
TGGGTTTCTCTCATAGAGTCGTTATCGAGTTCCTGATCTTTCTGCGAGAACACATCTTGGAAGTTGAACAAAGTCGCATTGCCTTCTGGTGGACGCCACC
ACCCCATGTCTTTGGCGACGCTGCGCAAGTTATCCGATACCAAAAAGTGCTCTGGATCGCTCGAATCCATCTCTGTGATCACAAATTCATTCGCAATAAC
GCTTGCGTGGTCATCGGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAGCATTGCCTGGATCAGCGGCGAACACATGGAACACTCAGGCTTC
GCCGAACTTGTCCACCATCACCGCTGTGCTCGCAGAATCGCCTCGCTCTCTTGATCTGTCATCGTCACTGTAGCAGTAACCGTGCTTAATTGCAAGATCA
CCCATGCACTGGATCGCACATCGCGCACTGATGCACCGCTGCATCGCTACACGAGCGATACCTTCGATAGAAGCTCCATTGGGTCCAGCGTACGAGGAAG
AGATAGCACCGTTCTTCCTGATCCTGAATCGGCATGGGCAGTGGATGATACTGAGCTGCTGGTCATTGATGAACGCGGACACGTAGCTCAAGTAGCCAAA
CGTGGACG