Description :
From Genome Similarity Track
Location :
Scaffold_1050:7915- 8936
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1050-fgenesh-gene-0.1Chromosome 04 contig 1, DNA sequence

Sequence
1021 bases(100 bases per row)
ACGTAGGCACATTGCTGGTGTATTGATGCTAATGTGGTGGATACTTACTTTGTAGATGCGCTCGCAGTTTGGCGTGTTGCTGGACCGAGGCGGCAAGTTC
TACGATCTGGGCTCAGGATGCGGCAAAGTGGTATCTTGACGCATTCCAGTAGCGCATTTCGTATCTTTGTATCATGCTGCCTAACGTCGATGCCGGAATC
TAACTTACAGGTCATGGCAGCTGCGCTCTTGCACGACTTTTCACAATGCTGTGGGATTGAGGTGCGTGCGTACGGCCACATGGGGATCTACTGTTGGCAG
AAATGACACTGAGCCCATTGCATTCCAGATACTGGAGGGACTGCATGGCATTGCGCTGAAAGTGCTGGACCACTGGCGCTACAAGATGCTCGACAGCTTG
CCTGCCGCGAAAGTCGACATTGACGTGGGCTTCACGAGGGCCGACGCGGCTGCGAACGTGAACATCTGGAAGGACGCGACGCTCGTGTTTTGCAACTCGA
CGTGCTTTAGTGGTAGTGTACGTGCGAAGATTCTTTGGTGTGTGATACAAGGTGGGAGCATATCTGGTGACTGTGTCTTGTTTGCTATGCGCTTACGAGT
AGCTCATCCAGTCCATTTCCACTGCGGCAGGTAAGCCCGCGCATCTTCCTAGCTAAACGTTTTGTTGCATGAATATGTTGTCGTTACTAATGATGCTGGT
GCTGCTACCAGATCAACTGAACGATGGGACGTATTTCGTGACGATCACAAAGCCGCTGTCGTCGAAGCGCTGGAAGACGATGCTTGAGCAGAAACTGCCT
ATGAGTTGGGGAAAAGCGACGGTGATTGTCCAGAAAAAAGTATTTTGACATCACGCATTGGCACCATGAAGTGAGCCAAACGAGGAACAAGACAATGCAT
TTTATACTCGACCACAGACAACAGCATAGCGCAGCATACGATTGAGGCATGCTTTTGTTGTATATTAGTCTCAAATGCCGATACTTTTCACGTTCCGTTC
GTTCGACTTACCACTAGACGG