Description :
From Genome Similarity Track
Location :
contig_25:791225- 794070
Transcript NameFunction/comments
g6242.t1ETO74361.1 hypothetical protein F444_09884 [Phytophthora parasitica P1976

Sequence
2845 bases(100 bases per row)
GCAAGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGGCGCCGCGCCAATAGCGACGAGGACTTGGACTCTGCTTCCCAAGACGCCGAACATGACTCCGA
TGTCGAGATTGTGCGCGATTTCAGTTCCAAGCGCGCGCTAGAAGCCGATCCAGACGCCTCCCAAGTGTCCCCGGAGGAGCGCGAGCGATTACGCGACCGC
GAGGAGCGCGACGCATTCGCCGAGCGATTGCGTCAACGGGACGAGGACCGCACGAGGCGCAAACGCAAGGCGGAGGAGCTGGAGGTTGCCGGGGGGCTCA
CGGGTGACGAATCCAGCAGCTGGCCAAGAGAGGAGCCGTAAACGACGACCAGAGCGCGCTCAGCGACAAGCTGCAGCGCCTGAGAGAGCTCAGCAGACAG
GAGTACCTTAAAAAGAGGGAGGAGAAGGAGCTGGAGCTGTTGGAATTCCAGCTCAAGGACGAGGACGTGCTCTTTGAGGACGGCAAGAGGTCCAGGAAGG
AGCAGCAGCAGCTGGAGCTCAACAAGAGGATCCTGGAGACTGCTAAAGCTAGGTCCCAGAAGGAGGAGGTTGACGGGTATCAGATCCCAGACTCGTACGA
AGAAGTGGACGATGAAGGCAACAGGATCAGGAAGAAGGAGGACTTGTTGACGGACAGATACGAGGAGGAGGAAGTGGTCCATACAGAGCAGGAGGTGTGG
GAGGACACGCAGGTCAAGATGGCAACGAGCAGGTTCGGGGTTAAGGAGAGGCACAGGGAAAAGAAGGAGGAGGACGAGTTCGTGTTCGACGACCAGATCG
ACTTCATCTCGCAGCAGATGCTGTCGGGCCATCATGTGAGTGAGGAAGACGTCCAAGAGGCGAGGAAGAAGATGGAGCAGGCGAAACACTTGAGTATCCA
GGAAGGAAGGAAGCAGCTGCCCGTGTATCCTTATCGGGAGTCACTGCTGGAGGCGATTCGGAATTACCCCGTGATTATTATTGAGGGGGAGACTGGGTCA
GGCAAGACGACACAGATCCCGCAGTTTCTGCATGAGGTCGGGTACTCGGAGCTCGGTATTATTGGGTGCACGCAGCCCCGACGTGTCGCTGCGATGAGTG
TGGCAGCTCGTGTGGCGCAGGAGATGGATGTGAAGCTGGGTAACGAAGTGGGCTACTCTATCCGTTTCGAGGACTGTACCAGTGACAAGACGGTGATCAA
GTACATGACAGATGGTATGCTGCTGCGTGAGTTCCTGACCGAGCCTGATTTGAAGACCTACAGCGTCATGATCATTGATGAGGCTCACGAACGTACTCTC
AGCACGGATATCTTGTTCGGCCTGATCAAGGATATTGCGCGTTTCCGAGACGATATCAAGATCATTGTGGCCAGTGCGACGCTGGATGCGACCAAGTTCA
GCGCCTACTTCGACGACGCCCCAATTTTCAAGATCCCTGGACGCATGTTTCCTGTGGATATTCTGTACACGAAGGCTCCGGAGGCAGACTACCTGGATGC
GGCTATCGTGACGGTGCTGCAGATCCATATCACGCAGCCTCTGGGAGACATCCTCGTGTTCTTTACCGGTCAAGAGGAGATTGAATCAGCTGAAGAGATA
TTATTGCAGCGCACCCGTGGTCTTGGCTCGCGAATAGGCGAGCTGCTTATTCGACCAATTTATGCGACGTTGCCGTCGGAACGCCAGGCCCAGGTGTTTG
AACCAACGCCTGAGGGCGCTCGCAAAGTGGTGCTGAGTACGAATATTGCTGAAACATCGCTGACCATCGCGGGAATCTGCTACGTGATTGACACGGGCTT
TTGCAAACAGACCAACTACAACGCGCAGACGGGCATGGAGTCCTTGCTGGTGGCTCCAGTGTCGCAGGCTATGGCGAACCAGCGAGCCGGTCGCGCAGGC
CGTACCGCTCCGGGCAAGTGTTTCCGTCTTTACACGGCGTGGTCCTACAAGAACGAACTTGACGAGAACACAGTGCCGGAAATCCAGCGTACGAACCTCG
CCAGTGTTGTGCTGCTCATGAAGTCACTCGGAATTAACGACTTGCTGCACTTCGACTTCATGGATCCGCCGCCAGAGAAGGCGCTCATTCGCTCTCTTGA
ACAGCTCTACGCCCTCGGCGCCCTGAACGGTTTGGGTGAGCTGACAAAGCTCGGACGTCGTATGGCTGAGTTCCCGCTGGACCCGATGATGTCGAAGGCT
CTACTCGCCTCAGAGAAGTTTGGCTGCACCGAGGAAGTGATGACTATCTGCGCCATGCTGAGTGTGAACAACTCGATCTTCTACCGACCGAAGGACAAGG
CCGTTCACGCTGATAATGCGCGACTCAACTTTGCACGTGGCGGCGGCGGCGACCACATCACGCTGATGAATGTCTACAACCAGTGGGTTGAAACGAACTA
CTCGACGCAATGGACGTACGAGAACTTTGTGATCATGCGCTCGCTCAAGACCGCCCGCGACGTGCGAGAGCAGCTCGAGGGCCTTTGCGACCGCGTGGAG
CTCGAGAAAACGAGCAACCGCAGCGACCACGAACCGATCCGCAAGGCGGTCTGCGCAGGGTACTTCTACAACACGGCCAAGCTGGACAACTCGGGGCACT
ACAAGACGGTCAAGAAGGCGCAATCTGTGCACATCCACCCGAGCTCGTGTCTGATCAAGCTCGAGGAAGTCCCGCGGTGGGTCGTGTACCACGAGCTGGC
CTTCACGACCAAGGAGTACATGCGCAGCGTGATCCCCATCAAGTCCGAGTGGCTCATGGAGCTCGCGCCGCACTATTACAAAACCAAGGAAGTCGAGGAC
GCCCGCACCAAGAAGATGCCCAAGGCTGTCGGTCGAGCAGGCTAA