Description :
From Genome Similarity Track
Location :
Scaffold_64:79120- 80591
Transcript NameFunction/comments
Sapdi_VS20SDRG_13874hypothetical protein

Sequence
1471 bases(100 bases per row)
CGCTGCCACCGCACGTCTACACGATCGCCGACAAGACGTTCCGCGCCATCACATCGGCATCGTGTAGCAACCAGAGCATTCTGGTCAGCGGCGAGTCGGG
CGCGGGCAAGACCGAGACGACCAAGATCATCATGAACTACCTCGCATCGGTCTCGAGCGTCAACCCGCAGGACGCGGCAAACGAGAAGGACAACGTGCGC
GACCGCATCCTCGAGTCCAACCCGATCCTCGAAGCCTTCGGCAACGCCCGGACCAACCGCAACAACAACTCGTCCCGCTTTGGCAAGTTCATTCGCCTCG
GCTTCGACCGCAGCGGGTCGCTCCTCGGCGCGTCCATCTCGACATACCTTCTCGAGCGCGTCCGGCTCGTCTCGCAGGCCAAAGGCGAGCGCAACTACCA
CATCTTTTACGAGCTCTTACGTGGCGCGTCGTCCGACGAGCTCCATGCGCTGGGTCTGACGCCGTCGATCGAGCACTATGGATACCTCAACAGCAGCCAG
TGCGTGGACCGCAAGGACGGCGTCGACGACAAGGTGCAGTTTGCGCTCACGCGGACGGCCATGACGACCGTCGGTCTCTCGCCCGTCGAGCAGTCGAGTG
TTTTCCAGCTGCTCGCGGCGGTCCTGCACCTCGGCAACCTCAAGTTTGTCAAAAAGGGCGTCGACGGCGCAACCTTTGCCGAGAGCAGCCACAGCCTCGT
GCGCACCGTGTGCACGCTCCTCGGGCTCGTGTCGACGGACCTCGAGTCGGCGCTGTGTACGCGCGAGATCATTGCCGGCTTTGAGCCCGTGCGTATGAAC
CTCTCGGTCGAGACGGCTGGGATGATGCGGGACGTCCTCGCCAAGACGATCTACGCGCGCGTCTTTGACTGGCTCGTCGACCGCATCAACGTCTCGATCG
CGTATTCGAGCAGCGGCAGCGAAGGCAGCAACCACAGCGGCGGCGCGTACCCGACGATCGGGATCGTCGACATCTTTGGCTTCGAGATCTTTGCGACCAA
CTCGCTCGAGCAGCTCTGCATCAACTTTGCCAACGAGAAGCTCCAGCAGCTCTTCGCCCGCTTCGTCTTTGAGATGGAGCAGAAGGAGTATGCGAAGGAG
GCGATACCGTGGACGTTTGTCGCGTACCCCAACAACGACGCGGTCGTCGCGCTCTTCGAAGGCCGACCGAATGGCATCTTTTGTCTGCTTGACGAGCAGT
CGCGGCTCTCAAAGGGCAACGACCGGACGCTCGCGGCCAAGTACTACGCAAGCTTTGCCAAGCACGCGCCGTTCTCAGCGTCCAAGCTCGAGCAAGGCCT
CAACTGCTTCTCGATCCAACACTATGCGGGCAAGGTGCAGTACGCCACCAAGGGCTTTTGCGAGAAGAACAAGGACCACGTGCCCGACGAAGCGCTGATT
GCACTGACGACCTCGAGCAACATCTTTGTGGCCGACCTCTTTGAGGACTGGGAGTACGCGTCGAACCGCGG