Description :
From Genome Similarity Track
Location :
Scaffold_64:79120- 80324
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10759Hypothetical protein

Sequence
1204 bases(100 bases per row)
ACGTGCAGGCAACCTCGATGGATGATGAAGCTCATGGACGTCGTGTTCTGGTAGACCGACGCATGGAAGTACACCCCCGAGTATGGAAGACGCTACGGAG
CCATCCATCTCCCCCTTGCTCCGCATGGCTGTGGCCCAGAACGTGCTTGCACCCGCGACGACGCGAAGCTCGGCGAAGCGCAAGTCGGCGATGATGGACG
ACTCAGCGCGAAAGGGGAAGCGCTTGGCACGCACGGAGTCCGACCCGAGTCTTCTCGAGACGCAAGAGACCAAGCTGGCATCGAGCGTCGCGAAACATCA
GGAGACCCTCGAGCAGTGGTCGATGGACTTGGCGGACCCGCGCAGTGCGCACCGCGCGACGAAGAAGATCCGACATATGCTCTACATCATGCACAAGTCG
AGCAAGCTCGTGATCGCACGGCTTCCGGTCGAGCAGCTCTTGGATCTCATGATCCTTCTCGACGTCCAGGTAGACGCTTAAATTGAGTTGAAGTAGATAC
TAATGTGCATCTTAGGTCACGGAGGCCCGGCAGATTGATCTCTTCGTGCAAGAACGCTTGGCAGATGAAGGACGCCTCCTTGAAGATGTCAACACAGCAT
TGGATGCCGCGACATCGATGCTTCTCGTCATGACGTCGCCGGACGTCGACCGCCGACTGCTCTCGGAAGAACACATTGAGCATTGCGTCTTGCTTGTCAA
GCATGTGCTTCAGCGATTGATCTACCCGGCGCTGGACGCTGCAACGTACTCGGTCGTTGTGAGCGAGAAGGAAAGAAAGAACGAGAAGGACAAGGCGCAC
GCAGCGCTCAAGAAGAAGATGGAGAAGGCTGGCCTTGTCGACATTGTCTACAGCTTTTTGGACTCGCTGCAAGAGCTCATGGGCTGTCTCAAGCTCCAGG
ACAGCTGGATTCTTCAACTCTCGAACGTGCTCATGGCCGTGTTTGCCATGGACAATCAGCAGACGTCGATCTCGACCGTGCAGCTGGGTGCACTGCGCAT
GCTTCGCGCGATCTTTGTGCACTACCCTGCCCACCGCACGCTTCTTCTCGAAGACGTCTTTTACGTTCTCGTAAAGCTCTCGACGAGCAAGCGCAACCTG
CGGACGTACAAGGTGGACGATGACTACGTGCAAGTCATCGTCGTGCTTTTGGCGACACTTGTCCAGTCGTGTATCGTGTTGTCGATGGATCAAGTGCACG
AGAC