Description :
From Genome Similarity Track
Location :
Scaffold_284:7911- 9436
Transcript NameFunction/comments
Hyaar_Emoy2813500phospholipase D-like protein

Sequence
1525 bases(100 bases per row)
TTCGAGCAACCTCTTCTCGTCGCAGCGGACTGGTTCCTGACCGAGGAGGAGATCACGGCATCTCGAGGTGGAGTACCTCGCTTGAACATGGTCACCTACA
GCACTGGTAACAATGTGAAGACGTTCACAGTGACGAAGGAGTTTTTCGACTCGCTCTACAACGATCTCTCATCGACCAAGGCCAATGATCGCGTTATGGT
GACCTCGTACAACACGGCGCTCATTCCATTCAAGCCTGAAACAGACCCGGAAGGTATCACCAGTCGCTTTGATGCTGTCTTTGGCGGCGTCGTGAAGCGA
GGAGGGGACGTCAAGATCATTTGCTGGGCGACCAAATTCCCGTCGAAACAAGACATCAACGTACGCGACAAGATCAACGAACTCCCGACGTCCGGTATCA
ACAACGGCAGTGCACAGTTCATTTTCGATGATCGGCTGCCCTATAGTCTATCGTCGCATCACCAAAAGACGGTCATCATTGCTGCAAGTGCCCCTTCTGG
AGCTGACAAGTATCCCGTTGCGTACGTCGGCGGCATTGATATCACCAATGACCGATGGGACACCATCTATCACAACGAGTCAGCACTTCGCGAAAAAGCC
GGTATTAACCTGGATTACAAGGGATGGGTCGACAGTAGTTTACGCATCCATGGACCGGCGGCGAAAGACGTTGCAGCGAATTTCCTGGATCGCTGGAACT
CGCCTTATCTCCCGACACAAGACCTTGTTGACAACCTCGAATCATTCCAGAACCCACAGTACTCGTTCCAACCCGCGCTGAACTACAGCAGTAGTAACAC
CACCTCGACGCTCGGACACCAGAGTGTGCAGATTGTGCGAACCTTCAGCTGCAAGTACAAGCACTACGAGTTTGCACCATTTGGTGAGAAATCGCTATTG
TACGCGCGCATCAAGGCCATTAAGAACGCCAAGAACTTCATCTATGTCGAGGACCAGTACTTCATCCACGTGCCCGAGTTGCTGGATGCCCTGATGGTGG
TCCTGCCAATTATTCAGCGTCTAGTTGTCGTCATTCAGCCACCGGAGCTAATGACCAAGAGCGGCGGATATGAGAAGTACATGTACAAGCTTGTCCAGCC
GATCAAAGACAAATTTCCGGACAAGATTCGCATGTACTCGATGAAGCCAGAGCTGAATGTCTACGTGCATAGCAAGATTGTGATCATTGACGACGTGTAC
TTGTCGGACGGCTCAGCTAACTGGAATCGTCGCAGCATGACTTCCGACGTCGAACTGAACGCGAACATCGTTGACTTGAAGACGGTCGATTCTCCTGACG
GTGTTACGGTGGGTAAACTGGTTCGTGACTTCCGTGTGCGCAAGTTTCACGAGATGACGGGACGGAGCTACAAAGAGATCAATAAGATGAAATTTCTCGA
CAGTGCGGACCTGTTCGACGCGGCAGCCGCAGAGAAGGGGTCTCTGATCAAGAAGTTCGACATTGGCAAGAAATTGTACTACAATGTCATTGGGAAGGGC
CTTCACCAAGGAATTGATCCGTACG