Description :
From Genome Similarity Track
Location :
Scaffold_25:79090- 80530
Transcript NameFunction/comments
g13296.t1XP_009520915.1 hypothetical protein PHYSODRAFT_478752 [Phytophthora sojae

Sequence
1440 bases(100 bases per row)
CTGCAATGAGCAACACACCACTCACACCTCGTACACCAGCGACGTACGCCATACCACTAAAATTCTACCGCTTGCAACGACAGGTATTGTAGTGCTTGAT
TTCCACGTGGAAAGGTTCGCGACTATACTAACATGTTTAAATGCTACCTTTTTTCTTTAACAGGAACGGCAAACAACAAGTTGCCTGATAGTCAGCAGGT
GCAGCAGCCGTGCATCGATGCGAGAAGTGCCTCCAGCGGTGCGAAATCCGATGACGGCCCCGTAAGCCCAATGAAAGATCTTGCTCAAATGACCAAAGTC
ACTGTGAAAACCGGAAAAAATTTCGACACCATGGAAGACGCGCTAGAAGATAAGCTAGCTGAACTCGTGGAGACGGCTGCCAAGGCCGAAAATATGCTCA
CCAAATGCGCTACATTGCGTAAGTCGTTGGACTGATTCCGACCGTTTTGGATTCTGCAGTCTTCATTTCTAACTTTTATGGTTGCTCTTTTTCAGACACT
ACAGCAAGCTCCCCGAAGCCTGCCCATTCCACCCTAACTCAAAGAAACAACCAAGAAAACTCGCAGCGTGAGGATAACAACAACACACCCGATGCCTCAC
GGGTGCCAACACCTGAAAGAAGATCCTCACAGGCCTTGGATGACAAAATCTCGAAGTACCCGGGTCTCAGCTCTGCTACCACTCGTACGCACTCCATCTA
CTGTAGTGCTTCGGTTGTATCGCTTGCTTGACCAACCAATGGTGCCCGTTCTTGTTTGGTCGTTGTTGCAGGCGCGGAATTTGATGCAATTAAAGCTGAA
TTACTTAACTCGCCGGAAGTGCAAGCAGCCATCTCGCGCATTCAAAATCCCAGCTACGGGTGGACACCATCTACAGGTAGACCCGGTTCATTCGCCTATA
AACTATTCGATCATTTTTAAGGTTTCTCTTGTTATTCTCCGTGTTCAGCAAAAGCATTTAGTGGGGCTTCCTCCTCACTTTCGAGCGAAAGTAGTTGCCG
CGCATTTGAAAAAGCTAACTCTCGGTATCCCACGCAGCGCACGGTGGCGGGGCCTTCGGACCCCAAACCATCTCCGTGGCCGCCAAGTCGTCAGTTTGGT
CGTTCGTGGGGATATGAACGCGAACGCAGCCTTCTGCCAGAATCCCCACCAGCAGATTACAGCAACTTTGGCTTCAGTGTGAACGACAACTTCTCGATGA
GCCAGTGGTATCGAGACTTGTACCCGAAGGCCTTCAACTTCCAACAGCTGTGACGATACGCGAAGTGCACACCGCGATGTATTGCGTGGGTGTCGTTGTG
ATGCTCAAAGTGCTTAAAAACTCAAGAAATCAATTTGCTGGTACAGCACAGGATCTCGTCGTCCTGAATAACGGGGCAGCGCTTGCAGAACTAGTTACTC
GCGTTGCACAAGAATCAGTCCTGGCAGCCAGTTATTTAAT