Description :
From Genome Similarity Track
Location :
Scaffold_49:790861- 793321
Transcript NameFunction/comments
Phyin_T30-4PITG_16803Putative uncharacterized protein
Phyin_T30-4PITG_16804Putative uncharacterized protein

Sequence
2460 bases(100 bases per row)
TTTGAGTGGAAACTGGATCAGCTGTCCATATAAGACTCGAGGGGAAATCCACATCACGTATGACGTAGACCACGCACGATACGAAGGGCTTCCAGATGCA
TGGCGAACGCTAAACCAGCAGTTTGAGTTGCCACTTGAAAAGGTTTTCAAGCGCAGCGTTAATGGGTATAAAGCCAAACAACCGGCTGTATTTGAAATGA
TGAAGACCTGCTTTCTAGCGCACAACGGAGCTCGTTCGGAAGGCGTGTTTCGCCTGGCACCGGACAAGGAAGAATGCAACGCGATAAAGGATGATATTAA
TGACGGGTCTTATGAAGATTGCTCCGATGTCCACATCATGGCCTCGCTCATCAAGGTTTGGTATCAATTTTGGGATAGTTGGTAGGATATGGGCTGTTTT
TTTATATCTCGTGAACGCGGCAGGGTTGGTTTCGAGAGCTCCCGGCTAGTTTGTTCAACATGCTTCCGGAGCAGCTGATTGCTCGCACTTGCAAACTTGT
GGTAACGATAGGAAAAGATGGCCACATGTTGTGGCGCGGCGACTGATGGTGCTCTGATAGTAACTGGAATCCTGAGCCCGTCGTTGTGCTGCAAACACTG
ACACAGTTGCCACCACTGCATCAAAGTGTTGTGTTGTGGCTACTAGACCTGCTGAATGAAGTTGTGAAGCACGAGCAGGAGAACAAGATGACCACTAAAA
GCATCGGTTTGTCTCTTGTTCGGCTTAAACTGTTTGTGTCTACTTAACCGCTGTTATAACAACAGCAATTGTCATGGTACCTAATCTACTGAGTGTCGAG
AACGCCGACGCTGCCGTGGTGATTGCAGTATATCGACAAGCTGCAGATGCTACTACAATGTAGTAACTACATGCACGAATGAGGCGGTCGCGAGACGGAC
GACGAGGGCTGTGGAGATGTATAGTTCAACAGTCGATGTGCAACATGCGAGTCTGGCAGATTCGGCAGTTATTTTTCTCTTGCTTTCATTTAAAATAATT
TAAGAACTGGATAAAGGCATCAAACAGGGCTAGGGTGTTAAAGGAGGGATGATCCGAAACGGAGTTTAATGAACTCGTGATAGTGCTTTAAAGTGTAAGC
GCTTCAGAGGTTGACTTGAGCATGACCTAACTATCTATACTCAGAGCCGTGTTGGTGCTCCCTTGATCATGCAGGGCGCTACTTTGGTGATAATGTTGCC
GCCGGTGCTGGTGGCTTTCAGGATTTGCGAGAAATGACATCCATCCCTTGTTTCATTTATACAGTGCGTAGTGGGTAATAAAAAGTTCTTTGTTTCGTGC
CTTTAAGTTGTTTGGTGCCTCAACATTTAAAGCTTAACGAGTTCTCGTTTGGTGCAACTATCCTTGACCATAATTTAAAGCTCAATGCTTAAAAAATGTG
CAAGCAAAAACAATGGAGAACGGGGTGTGGGTACTGTCGATCCATCTATCCAATATTTAAGCGAAGGCTGCTTACACAAGGCAGCCGTACTCAGGGGAGA
TGTGGCGAAAGATATCGTCCTCGTGACATTCAACTCCACTTGAAGCGATCGATGACGGCTCTTCCCAATTGCAAGTGCTATTATCAATAGCTGATGCAGC
CTGCGGAACCACGGCACTTGCTTTCCGCAGGGCTGTTGTCGGCGACGGTTGCAATGGGAAGAAATCGTACGAGACGGCGTCAAGAGAATAGCCACAGGAA
GGGTGGTCATTCTCGCCGAATGGGTCCATGGTGGAGGTGCTGAGCTCACCGAAGGGGTCGTACATGGCGTCGAAAATGAAGCCCACCTGAGTGGGAACCA
TGGACGCTTGGCTGTGTTGATTGAACTGCGCTCGACCGTATTCGGCCGCCGCACTCGTAGCCATGGGGTTACCGAAGAACATTTTGTCACGGTGCAGTGA
CGAAGCTGAGGATGGCGAGTCCGTGAAGAGGTGCTTGCGTGCTTTGGTCCTGTATACAAAGCGCCCGACGCTCGGCCGCGGACTCTGCGATCCACACGAG
TCCTCGTCCGAGTCGTGGTCGTCGGGGGTATTGCTTCCGTCCGCGGTGTCGCCTTGAAAGAAATGGGCAGGCAGAATCTGACCGAAAGGGTCAATGCCGT
ACGTCTCAGGCGATAAGAGGCGCTTGAGTTGGCTTTGATAGCCTGCGAACTGACGTAGCTGCTTGTCTGAGAGCGGTGGGCCCGAGCCATCCTGGGCCTG
ATGTTGACATTGCTCCAGCTCCAGTAGCGAGCGCTTGAGGCTGCGTACTTTACGGTAGGGCCAGTGGCGGATGCCGATGGCTCGGCAGCGTTTCTTGAAG
GCAGTGGCGCGGACACCAAACTTCTCCGCCGCTACCTTGAGTGGCAGGTGAAAGTGACGACTCAGAGCAGCAAAGTTGCACGTAGCTACGGGAAGTGGCG
ACGCTGAGTCGTCCGAGGCCACTGGCGAATCGCAAGCCTCGCGCTTCTTGAAGTTGTGGG