Description :
From Genome Similarity Track
Location :
scaffold_36:79081- 80863
Transcript NameFunction/comments
g1668.t1hypothetical protein

Sequence
1782 bases(100 bases per row)
AGTTGGCAAGTTGTCGTGAATCGAGAGAAGTCACTTTTCGTTTAGCCTTTGAGTCAACTTTGCCGCCATGGGACTCGAGGAAGGTGGCATGAAGCAGCCT
CTGGACCATTCCAGGTCGAACCGTAGGCCGTGGGCGTCTTGGCGTCTCGCGGTGTTAGCCACGGTCGGCGCGTTGCTGGTCGTGACCCAATTGACCAGCT
ACTCACCCCATTTCCACGCACATATCGCCAAGCACCGCATTCTTCGCAGTCTGCAGGAACAACCGGCACTTCGACTGTCGTTTGAAATCAAGCGAAAGGC
CATGTACGTCCACGGAGCGTCGACCTTCGACGTCGTTGCGACTCCAGCGCCACAGCGCTCAGCCGACGATAACACTATGGTGTACAACGGAATGGCGTCG
TTCGAGAAGGACGGCCACACCCACGAGTACTCCCTCGTTGACGGCACGACGTACTACACGCGTCGTCCGAACGGTTCGCCGGTAGCCGAGGCAGACGCGG
GATGTTTGCCGGCCGGGTCGGTGCCGCCTATCGGGAGCGTCTTGAATGCCATTCACGGCGCCACCACAGCTCAGTCCGGTGGTGCGAACGACAAATGCCC
CGGTGGCTCCGTCATGGTGTTTCAGTTTGCAGGTGAAGACTTTGTGCTGTGTTCGAGTCAATCGCTTCAGGACGGGTTCCAGATCTTCGGCAAGCACTTG
GATATTGGCGTGAAGTACGAGCAAACCGCTCCCGTTATTGTGGCGCCGCGTGTACCGACGGCGGCGTTGGCTTCGTGTGGGAAGGCCCCGTTCGGCGAGC
GTATCACCCCGTCACTGCCGTCGCTGCTTACCCGCTCCTTCTCCGAGTGGAGTCACCGTGCGCTGCGTGCGGAGGAATCCCAGGGTTTGTTCGATAGCGC
GTGGGACCTCATCACCGACAGCTCTTGTGGCTGCAAGGGCGCTAAGCGCGCTTGTGTGTTCGTTGCGGGTCTCAGTTCGTACGATGACCGCGGTCTGACC
GAGGACGATCCGGAAGGCTACTTCGGCGATGAAATTGGAGACCATTCGCCTTGTTGCTCGAGCAGGAAGTTCATCACGTTGGCTACGAAGGAGAACACGT
GGAATGACCCGGTCTTCCAGCAACGTCTGGTCGATTTGGTTGTGCAAGTGAGCGGTACGAGTGACCCAGCTACGGGGACGATCAAGGACACGATCTACGT
CGGCCACTCAATGGCGAATCTCATGCTGGCTGGAGCTATTGCTAACAAGAAAGCCACGCTTGACCCGTCCTCGACGTGGGTAGCTGCCAGCGCCCCAATG
GAAGGAAGTATGGGCTCCAACTACATTCAGGAGTCGTGCAATGGACAGCAAAGCGGCTTCGTGGCTAGTATCATTGAGCTGCTGGGCAACTGTCCTGCCA
ACACCGGAGAGACGTCGCTGGCCTACCAGGGCTCCAACTTCTCGTCGCAGCCGTTAAACGATGCCTACGCTGGTGCTCAAGCTGCGTACGTCGAGAATGT
GGACGCTGTTCTGTGCAGTAACAGCTTCACAGGCTTGGTAACTGTGAAGGCCGCTATCTATGCGTTGGCTGGTGAAGTGTTACCCCACCATTCCTCGGAG
AACGATGGTATTGTCGAGTACTCGAGCTGTACAATGGGTTTGCCGCTGGACAGCTTCGATACCTCGTACGAGAGTGTTCGTTACAGATCTAAGCTGAATC
ACGTGGACACTTCATTCCGGAACGGCGACGGCGTCTTTAGCGACTCCAAGAAACCGTTGAAATGGTTTGAGTGTCTCCTGTA