Description :
From Genome Similarity Track
Location :
contig_3:79081- 80084
Transcript NameFunction/comments
g740.t1fatty acid desaturase family, Zn-binding site

Sequence
1003 bases(100 bases per row)
AACATCGGTGCCAAACGTGCAAGTGGCCAGAAAGTTGGCGGGCAGGATAGGACAGCGGCAGGGCGGGGGTGACTTGGCGCTCGATCATTCGCCACTCGGC
CAGTTTCGTAATGGACTCGCAGATACAAGGTGGCACCGAGACTGCGTTCAGGCCCAGTCGTAGCAATCGAGTGCGACAAAAAGCAGCGAAATCAGAGTCG
GCGGAACGGAGCAAAGTGATCACTTATTCTGCTGCCAGCTAGAGCTTCGACGAGCATCACGCGCGACCCGCCATTGCACGTCCCTTAAAAGCCGAAAGCC
CGCCATCGCAACCGGAGCACACGATTGCTCGTCGAGGAAACGACTGGTCCCAGTTCGGGGAGGCGTGATTCCTGCCCCACGTTCAAAATGCTGCGTCAAC
TTGTCTTTGGAGCGTGGTGCTGGTCCGGTAGCGATGATTCACGCGATCACAAATGTTACTTGCTGATCAACCAGCACGGTTTACTTGGAGTAGGCGTGGG
ACAAGGGCAGCTGAGGGAGCTGCTGGTGGTAAGCGCGCGCAGGGAGGGAAAAGATACTTCGGCTTTGCCGCCGGCGTTCCGTTGGTCATGCACCCTGGGG
GCCGCTATATGTAGCACCAACGACACGCGGCCTCATTGCAATTGCCTCGCCCCTCATCACCGCTTGCCGGGCGCCATTGTCTGGTGTCGTGGTGGATCCA
TCTCCAGCAGCGGTAAAGCTGTTGCGCCCACCAATCCTGTTGTCCCATTGTACAGCCGTGCGTTGGCTTGCGCCCAGTATGCATGCCGTATGCCGTTCGA
CAGTTCCTGGGCGGTTTCGGGTCCGTTTCTACCTCCGGCTACGTACTGCTCCCCCCTATCGATCACTTTCGATTTTGCGGGGCGCGGCCGTCAAGTGGGG
AGCAGCACCAAGAGTTTCTAGACACAGAACCATCCAATCATGTGCAAGGTGGAGAAGAGCAACCTGCCGCCCATGGCCCCCGTGGAGCCGCAAGCCGCCA
AGC