Description :
From Genome Similarity Track
Location :
Scaffold_5:790804- 794411
Sequence
3607 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTGTTTCATCAACCACCTGAGTTTCTTGATGTACGCATAGTCAACC
ACTCCAGCGGCGCATATAAGCGCTTCAGAGGCAATAGCAACGGACACTCGCTCCATCATCTCTCCACGAGGATCGCTGAATCCACGACAATACAGTTCCA
CTTTGCCAGGTCCATTTTGACGCAAAATAAAGCAGAAACTCAATTCTCCCCGAAGAATACCCAATTCCGACAATTTTGGAACACCACGTATTGCCACAGA
ATTTCAGGAGAGCACAAATTGGATTAATATTTTTCGATTAAAGTGGGAGATTGGGTTGGTTTTGAAAACAACTTGCTCGACTTTGATATTACGTTCCGTC
CGAGTGACGTCGCTAGGAATGGAGAACTATTACGGAAACTACCGAGCATGGGACCAAATACTGCGGTCTCAATGATTCGTGTGTTATGATGGAGACCATT
TTGGTTATTACGATCGCAATGACCTCTACCGCGCTGGGTCTAGTGGCCGCCATTTCGTCGGCTGTTTCGCTCTCACCCTGAATCAGTTTTACTGATTATA
TAGATAGTATAGACCACGGGAGGTGGATTCATGAAAGCTTTACACTCAGACGAAGATCATCTCTACTGTCACTCATAATTTCACATCATACCACGGTTAT
TCGACTAGAACCAACCGCTACCCTGTCTGGATACAGAAGATCAGTTACATCAATGTAAACTCGTATGAAGATCAAGGACTTCGGCGCACAAGTTTAAAGA
AACAGTATCTCGACTCACCATTCTTCAGACAATTTCGGAATATGAGCTACAGATGCAAACGCTGCACCTGCGTTGAAGTGTTGTTACTCACGGGATACTC
ATTTTATGCGATCAAATCTGCTAGGCTTCGTCCGTCGTATTATTACTGCTAGCTGGCCTGCTGTCTCGAAAGCTATTAAAAAAATTCAACGTGCTGCTTA
TCCGCTGGTACGTAGATCCTGACAAAGGACTGTCTCCTATGCACAGTCCCGTACATGACAAAATAAATATCAGAAAAACACTTGGCTAGAAGAAGCTACG
CATGTAGCTAAACATTTTAAAGTGAGATGCGATTGTGATAATCACATTGGTCTGGAGTGTGAAGGAGTTCTAATGCAACAGCTAACAGCATTTCGAGCTG
CCGTTCGCTGCGCGGCACTGCGTAGTAGAACAATTATTGTGTAGTGGAGCGATAGAACGAAGAGAACAGTTGAGCTATATGAGGTGAGTGGGAAAGAGGA
ACACTTACCAGCACGTACCTTTGGAGGAAAGTGCTCAACAATAACAACTTTGAACGTTAACTGGTGGCCAACGAGCCAATCATCAACCCATTTGAGCACC
GTCAGAAAACTTGAGTTCGTATCGCACGGATATTCATCCGGAAATTCTCACAACAACCGATATGAAGACCTTGCTGATACTATGAGTTTTCGTCTGAGAA
CCTGTTGGCTTCTACAGTACTGCACCCCGTTTTCGCGCCTTCGGACCTTTAATAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN