Description :
From Genome Similarity Track
Location :
Scaffold_35:79074- 80525
Transcript NameFunction/comments
Phyra_78834Amino Acid/Auxin Permease (AAAP) Family

Sequence
1451 bases(100 bases per row)
GTAGTACACCGTGTTCTCGTATTCCGAGTCGCAGTACGGGAACGACACGTCCGAGTCCGTCGGGGCGAAGAGCGTCTTGCCAGACGTGTACGTCACGTAG
CAACCCAAGAACGTACACACAACCACCACAATGAGAGCGGGGACCTTCTCGTACATGGGGATCGTGTTCCAGCACTTCTTGAGCAGGAACACGATGGGCA
GGATAATGCTGTTGAGCGAGATGCACGAGGCGCCCACAAAGTCCGACAGGTCCGAGAAGTGGTCCCTCAACACGATGGACAGGACCACCAGCACAATGAT
GATAGCAATGCGCATCAAGACGTACTTGATGGTGTTCAGTCCACGGTACTCGGCGGCCTCGGCCTCCGCGTCACCAAAGTGCGGGTTCTCAGCGTCCGCG
ACCGAAATGTACGACATGCCTGAACGACGCTCCGACACATTGGCGGGCGGGTTCACGGACTCCTTGGCGGGGGTCCCCATGTCAGCGTACGTGAGACCGC
TCTCAATATCGTTCTGGTCCTTCTTGTGCATCCCGAGGGCGAGACGCTCCGACAGGTAGAACACGGGGTTCAGCAGCACGGAGAAGGCAATGGTGATGTG
AAGCTGCATGAAGAGGTAGGCCAGGACAACAGCGCCCCAGTCCGACTTGAACCCCAGCGTGGTCATGCCCGTGTCGGCGTCCGGGTAGATGGTGAACAAG
AGGTTGCCCGAGATCTGGCAGCCCACAGCCGAGTACGCCGTGCTGGCCAACGTCAGGAACAAGCACGAGATGAGCGTGATGGTGAAGAAGACTACACGGG
GCATACGCTTGGGCTCGCTGTGTTGACGTTGCAGAGCGGGGATAACGACACCAGCGCCGTACGCCAACGACAGGTTACCGAAGACACCAGCCACCTGCTC
GAACTTGAGGTCGGGCGCCGGCACTGTGGGGTGGCCACGCATGCCGTACATGACGACGGCGACACCGATAACATCGGCGATGACGGTGCCTGCGCAACCG
GCAAAGGCAGCACCAGCTCCTTCTTTCAGAGTGGGGATAAGGCACACGGGCAGACACATGAGCGCCATGAAGATGATCCACACCGACTGACTGAAGGCGT
CCGGGAAGAGGCCGTCGAGCAGCGAACCTCCCAGCACGAGGAAGACGCAGGGCACGAGCAGACACGAGGCCATCTGAGCCACGACAGCGAGCCAGTGACC
CCACCTGCCCATGACCCAGTGACCCAGATCGCCGTAGGTTTTGACGGACTTGGGCGCCAGCAGCATGACGCGGCAAATGGCCACCGAGGCGTAGACGTTG
GCGAAGGCCATGAACAGCATGGCGATGACGGCCAGGACGGGGCCAGCACGCGAGAAGTTGCCGGGCATACCAAGTGTACCAACGCCGTAGACGCAGCAGA
AGACGTTGAAGGCCATCTTGAGGTCCTCGAGCGTGAGGAACTTCTCGCCGC