Description :
From Genome Similarity Track
Location :
Scaffold_181:79031- 81309
Transcript NameFunction/comments
g4865.t1hypothetical protein
g4866.t1hypothetical protein

Sequence
2278 bases(100 bases per row)
CGACTGAGTGGGCATTGAGCTCCACCTTGATGCAATACCATGATGACAAGTTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAA
CTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGA
ATGGGTGCACAAATCTAAGACACTGTTCGGTCGAGCGACCCACTTTGTGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGAT
TGCACGTTTGCCCAGCTTCTACAAGCTGGCCTCACAAGCTTCGTGGAATTGGAAGACTCGTTGGCCCCGGTTACACCGCCGACGAAAGGGTCACCTACTG
CTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGA
ATATGGCAGTTGCTCGTGGATTTTGTGGAAATTACCAGAATGGACGGTAGTGACGGCTGCGAGTGCTTATCTCGAGACAACCACGGTAAACCTCGCCGAG
TATGCTGGAATGAACAATGGCGTCTCGGCTGCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTTGGAGATTCGAGACTCGCAATCCAGCAGTCCCTAG
GGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTACAACTGAATCGTCACCGAGAGCTCACGACCAAGCTGCGGTCAGTGAAGTATTTGCACGTGGTCCG
AGAGTTCAACGCTGCGGCAGATTCGTTGGCGGGTGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTGCGACTGAGGCTAGGAAATTAGAATTGGTCGAG
CTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGTGCAGACCACGGCCGAAGAGAAACCGGCAGTCAGCTTCGCCCGAGCCAAGTAGCCCGTGGAAT
CTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACGAACCCGACTACCTAACTGCAACAACCAGAAACCAAGCAAAAGTGAGGAAGAAACGAGTCCAG
TTTGCAGATGAAACGTCGGTGATAGAGCCGAATGGTGCAGCTGAGCGAGACGAAGCGAATGATGTGACCACCGAAGCTCAGAGCGAGCTGGGAGCCGAGC
AATCGAGCAACGAGGCGGACCCTGGCGCTCCGAACGCAGAAGATGTTGACCCTGTGGTTATACAAGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGA
TGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCCGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGATAAG
TTCGTGCTTAGCGAGGATGGTGTACTGTGTTTTCTTGGAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAAACAACGATGCGTCTAGTGGTGCCCA
CAACGATGATTCAAGAAGTACTACGGAGTTGCCACGACTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTT
TTGGATTGGACTATATGCAGACGCCGAACGACACGTCAAGTCCTGCTCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGA
AATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGATGGATTTCGTCATACCGTTACCGAAGTCTCGTCGAGGCAACTCAGCCCTACTACTGTTCCAGT
GCGCATTCACAGGATTCGTCATGGGTAAAGCTATGTCGGACACCACCGCTCTGAAAGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGC
ACCAACTCTAATCCGACATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTGAGC
TATCGGCCGCAGGCGAACGGACAACAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGAACCGCTGCAGCAAGACTGGGACG
AGATCGCGGAGCGATTGATCTTCGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCAC
GCTGCGAGCGATGTCGGCATCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAA