Description :
From Genome Similarity Track
Location :
contig_118:79020- 82154
Transcript NameFunction/comments
g13339.t1hypothetical protein

Sequence
3134 bases(100 bases per row)
GACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGC
ACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCGTTTATACATATGGCGAATTGAATGCACCGA
CTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTG
CGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGACTCT
ACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGCGCGTTTGTATGGGGTAGAGGGTCCTATACACGAGAGGACA
GTATAGTGAAATCAAGACAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCG
AGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGT
CATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTA
GCTGAAAACTTGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTT
AGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTC
TTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACT
CGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGCCGGTGCTCCGTGTCCT
CCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGA
CCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCAC
AGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTATACATATGGCGAATTGAATGCACCGAC
TCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAACGTAGGATTCTACGTTTCAACATGTGCG
GAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGACTCTAC
GTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGT
ATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGA
GGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGT
CATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTA
GCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTT
TAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGAC
TTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGA
CTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCG
TGTCCTCCATTTATTGGCTCGGCTTTCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAACTC
CGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGA
CAGCACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTGAATG
CACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAA
CATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAGCATGG
GACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAG
AGGACAGTATAGTGAAATCAAGACAAACCGGAGA