Description :
From Genome Similarity Track
Location :
contig_25:790181- 793025
Transcript NameFunction/comments
g5047.t1pre-mRNA-splicing factor ATP-dependent RNA helicase, putative

Sequence
2844 bases(100 bases per row)
GCAAGTCGCGTCGCTCCGACGGCTTCTCCCGTCGCCGGCGCCGCGCCAATAGCGACGAGGACTTGGACTCTGCTTCCCAAGACGCCGAACATGACTCCGA
TGTCGAGATTGTGCGCGATTTCAGTTCCAAGCGCGCGCTAGAAGCCGATCCAGACGCCTCCCAAGTGTCCCCGGAGGAGCGCGAGCGATTACGCGACCGC
GAGGAGCGCGACGCATTCGCCGAGCGATTGCGTCAACGGGACGAGGACCGCACGAGGCGCAAACGCAAGGCGGAGGAGCTGGAGGTTGCCGGGGGGCTCA
CGGGCGACGAATCCAGCAGCTGGCCAAGAGAGGAGCCGTAAACGACGACCAGAGCGCGCTCAGCGACAAGCTGCAGCGCCTGAGAGAGCTCAGCAGACAG
GAGTACCTTAAAAAGAGGGGAGAAGGAGCTGGAGCTGTTGGAATTCCAGCTCAAGGACGAGGACGTGCTCTTTGAGGACGGCAAGAGGTCCAGGAAGGAG
CAGCAGCAGCTGGAGCTCAACAAGAGGATCCTGGAGACTGCTAAAGCTAGGTCCCAGAAGGAGGAGGTTGACGGGTATCAGATCCCAGACTCGTACGAAG
AAGTGGACGATGAAGGCAACAGGATCAGGAAGAAGGAGGACTTGTTGACGGACAGATACGAGGAGGAGGAAGTGGTCCATACAGAGCAGGAGGTGTGGGA
GGACACGCAGGTCAAGATGGCAACGAGCAGGTTCGGGGTTAAGGAGAGACACAGGGAAAAGAAGGAGGAGGACGAGTTCGTGTTCGACGACCAGATCGAC
TTCATCTCGCAGCAGATGCTGTCGGGCCATCATGTGAGTGAGGAAGACGTCCAAGAGGCGAGGAAGAAGATGGAGCAGGCGAAACACTTGAGTATCCAGG
AAGGAAGGAAGCAGCTGCCCGTGTATCCTTATCGGGAGTCACTGCTGGAGGCGATTCGGAATTACCCCGTGATTATTATTGAGGGGGAGACTGGGTCAGG
CAAGACGACACAGATCCCGCAGTTTCTGCATGAGGTCGGGTACTCGGAGCTCGGTATTATTGGGTGCACGCAGCCCCGACGGTGTCGCTGCGATGAGTGT
GGCAGCTCGTGTGGCGCAGGAGATGGATGTGAAGCTGGGTAACGAAGTGGGCTACTCTATCCGTTTCGAGGACTGTACCAGTGACAAGACGGTGATCAAG
TACATGACAGATGGTATGCTGCTGCGTGAGTTCCTGACCGAGCCTGATTTGAAGACCTACAGCGTCATGATCATTGATGAGGCTCACGAACGTACTCTCA
GCACGGATATCTTGTTCGGCCTGATCAAGGATATTGCGCGTTTCCGAGACGATATCAAGATCATTGTGGCCAGTGCGACGCTGGATGCGACCAAGTTCAG
CGCCTACTTCGACGACGCCCCAATTTTCAAGATCCCTGGACGCATGTTTCCTGTGGATATTCTGTACACGAAGGCTCCGGAGGCAGACTACCTGGATGCG
GCTATCGTGACGGTGCTGCAGATCCATATCACGCAGCCTCTGGGAGACATCCTCGTGTTCTTTACCGGTCAAGAGGAGATTGAATCAGCTGAAGAGATAT
TATTGCAGCGCACCCGTGGTCTTGGCTCGCGAATAGGCGAGCTGCTTATTCGACCAATTTATGCGACGTTGCCGTCGGAACGCCAGGCCCAGGTGTTTGA
ACCAACGCCTGAGGGCGCTCGCAAAGTGGTGCTGAGTACGAATATTGCTGAAACATCGCTGACCATCGCGGGAATCTGCTACGTGATTGACACGGGCTTT
TGCAAACAGACCAACTACAACGCGCAGACGGGCATGGAGTCCTTGCTGGTGGCTCCAGTGTCGCAGGCTATGGCGAACCAGCGAGCCGGTCGCGCAGGCC
GTACCGCTCCGGGCAAGTGTTTCCGTCTTTACACGGCGTGGTCCTACAAGAACGAACTTGACGAGAACACAGTGCCGGAAATCCAGCGTACGAACCTCGC
CAGTGTTGTGCTGCTCATGAAGTCACTCGGAATTAACGACTTGCTGCACTTCGACTTCATGGATCCGCCGCCAGAGAAGGCGCTCATTCGCTCTCTTGAA
CAGCTCTACGCCCTCGGCGCCCTGAACGGTTTGGGTGAGCTGACAAAGCTCGGACGTCGTATGGCTGAGTTCCCGCTGGACCCGATGATGTCGAAGGCTC
TACTCGCCTCAGAGAAGTTTGGCTGCACCGAGGAAGTGATGACTATCTGCGCCATGCTGAGTGTGAACAACTCGATCTTCTACCGACCGAAGGACAAGGC
CGTTCACGCTGATAATGCGCGACTCAACTTTGCACGTGGCGGCGGCGGCGACCACATCACGCTGATGAATGTCTACAACCAGTGGGTTGAAACGAACTAC
TCGACGCAATGGACGTACGAGAACTTTGTGATCATGCGCTCGCTCAAGACCGCCCGCGACGTGCGAGAGCAGCTCGAGGGCCTTTGCGACCGCGTGGAGC
TCGAGAAAACGAGCAACCGCAGCGACCACGAACCGATCCGCAAGGCGGTCTGCGCAGGGTACTTCTACAACACGGCCAAGCTGGACAACTCGGGGCACTA
CAAGACGGTCAAGAAGGCGCAATCTGTGCACATCCACCCGAGCTCGTGTCTGATCAAGCTCGAGGAAGTCCCGCGGTGGGTCGTGTACCACGAGCTGGCC
TTCACGACCAAGGAGTACATGCGCAGCGTGATCCCCATCAAGTCCGAGTGGCTCATGGAGCTCGCGCCGCACTATTACAAAACCAAGGAAGTCGAGGACG
CCCGCACCAAGAAGATGCCCAAGGCTGTCGGTCGAGCAGGCTAA