Description :
From Genome Similarity Track
Location :
contig_118:79014- 82148
Sequence
3134 bases(100 bases per row)
CGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAG
CACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCGTTTATACATATGGCGAATTGAATGCACCG
ACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGT
GCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGACTC
TACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGCGCGTTTGTATGGGGTAGAGGGTCCTATACACGAGAGGAC
AGTATAGTGAAATCAAGACAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCC
GAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAG
TCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGT
AGCTGAAAACTTGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTT
TAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTT
CTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTAC
TCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGCCGGTGCTCCGTGTCC
TCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCG
ACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCA
CAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTATACATATGGCGAATTGAATGCACCGA
CTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAACGTAGGATTCTACGTTTCAACATGTGC
GGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGACTCTA
CGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAG
TATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCG
AGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAG
TCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGT
AGCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCT
TTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGA
CTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATG
ACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCC
GTGTCCTCCATTTATTGGCTCGGCTTTCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAACT
CCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCG
ACAGCACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTGAAT
GCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCA
ACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAGCATG
GGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGA
GAGGACAGTATAGTGAAATCAAGACAAACCGGAG