Description :
From Genome Similarity Track
Location :
Scaffold_66:7900- 9027
Sequence
1127 bases(100 bases per row)
AGGTCCCACCTGATCGAGGCGTACGGCACGAGATTAATCTCGCGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCCCTCCCGCGCGAACAGTGCGA
GGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAACCGAAC
GGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCTGGCCCAAACACCAATCCCACGAAAGGATGTGTTGCTGAACAACATGG
CCTGTACAGTGCGCTAGATTTTGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTT
TGGGAGTGGCTCGTCATGACGCAGGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTAGTGACGCATTTGTTCCGCCCTTTGCGTACCTTCGTACAGA
CGTACTTCCACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTTCGTCGAGTGTTGGACGTAATGCG
AGCGAACAAACTATACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGCAAGCAACGTGGGCGTTCGGGCTGAC
CCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGACCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCATAAGTACAGCG
CAGGGTACGCGGGCTTCGCTAAGCCCTTGTCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCC
AGTCTCCAAGAGGCCTCTGTCCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCTATCGGATGTGCATTGCTGC
AGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCCGTCCATGACAAGGAGCTCCTGGC
AATGAAATATGCCCTTGTGAAGTTCTG