Description :
From Genome Similarity Track
Location :
Scaffold_204:790- 3015
Sequence
2225 bases(100 bases per row)
CTCTTACGCTTCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCT
CGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTTGTGAGCCGTTACTCAAAGGCAATCGGTCTCGTCGTAAGCGCCGCAGAG
ACATACGACATATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAG
ATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGTGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACAT
CTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGT
GCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGCTGTTGAGTTATGCGTGTTCCTTTGGCTCAGTTAATAGAG
CGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCTGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTT
ACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCT
GTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTGTGAGCCGCTACTCAAAGGCAATCGGTCTCGTC
GTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATAACGGCTTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCAAAATGCACC
AGCTATCCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCACCACAATCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCT
GCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCATTGATACGCCTGCGGTG
GTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGGTGCTC
CTTTGGCTCAGTTAATAGAACGTCAGTCTCATAATCAGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTC
TGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATGATGTGCGTCTCTT
AATTCGGCTTGCTCCCCGCTGTCATCCTCATTGACTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATTGTGAGCCGTTACT
CAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGGCATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATT
CGTCCGATGCAAAATGCACCAGCTATCCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCACCACACTGATGAGTAGCGGTAAAGTGCG
TGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCG
ATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTGCAGGTGATGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN