Description :
From Genome Similarity Track
Location :
Scaffold_2559:790- 2725
Transcript NameFunction/comments
Phyta_totarag14621hypothetical protein PHYSODRAFT_517932

Sequence
1935 bases(100 bases per row)
TTTCAAACATGATCAGATTTATTTATAGTCGCCGCCAAACGGCAAACATATCACTCATCCAGCTGCCTAGCTCTCGTGCTCGGCCGTGTAGTTGTAGTAC
ACGGTGTTCTCGAACTCCGGCGCGCAGAATGGGAAGTCcctgtcgtcgtcgctgggaGCGAACAGGTTCTTGCCTGACGTGTACGTCACGTAGCAGCCCA
GGCAGAAACACACGACGACCACGGTCAGCGCCGGGATCTTCTCCCACATCGGCATGACGTTccacctcttcttcagcaagaACACAATGGGTAGGATGAT
TGAGTTTACCGTGATGCACGACGCCCCCGCGAAGTCGGCCAAGTCGTGGAAGTGGTCCTTCAGGATCACCGACGCGATGACCAGGCCCGTGATAACGACG
AGGCGCAGGATGATGTACTTAATGGCGTTCGCGCCACCGTACTCGgcagcctccgcctccgGATCGCCGAGGTGCACGTTTTCGTTATCGGCGACAGAAA
GGAACGAGCGACGCTTTGAGGTGTGCGATACGTGTGCCTGCTTCTCCGAgcgctcagcagcgtcagcaggaGTGGACACATCGGCGTAGTTCAACAGGTT
GTTCTcgacgtcagcgacgacaggCTTGTGCATGCCAAGCACGATGCGCTCGGCGATGTAGAAAGCCGGGTTCAGGATAACGGAGAAGGCGATCGTAATG
TGTAACTGCATGAAGAGGTAGGCGAGGACAACCATACCCCAGTCTGATGCGAAGCCGAGCGTGGTCAGGCCAGTCTCCGCGTCCGGGTAGATGGCGTATA
GGAGGTTGCCCGAGATCTGGCAGCCGACAGCCGAGTACGCCGTGGTGGCCAGGATGAGGAACAGGACCGAGATGAACGACATCGTGACGCCCACGACACG
GGGCATGCGCGTGGGGTCGCtgtgctgacgctgcagcgccggAATCACGATACCGGCACCGTACGCGAGAGCCAAGTTGCCGAAAGCGCCAGCTACTTGC
TTGAAGTTGAGGTCGGGCGAAGGCAGACTCGAGTGACCGCGCATGCCGTACAtcacgacggcgacgccgaTCACATCAGCGATGATGGTGCCCATGCAAC
CGGCGAAAGcggcgccagctccttcctTCAGAGTCGGCACCAGACACACAGGCAGACACGTGAGCGCCATGAGGATGATCCACGTCGTCGCGCTGAAGGC
TTCAGGGAAGAGGCCGTCCAGGAGCGTGCCGCCCAACACGAGGAACACGCACGGCACCAGCAGACAGTTGGCCATCTGCGAGATGACCGAAAGGTAGCGG
CCAGGCTTGCCCATGCACCACTCGCCGAGATCGCCGTAGGTCTTGACGGACGTGGGCGCGAGGAGCATGACACGGCAGATGGCCACTGCACCGTACACGT
TGGCGAAGGCCATGAAGGCCATGGCGATGATCGCGATAAAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGCGTTCCGATGCCgtagacgcagca
gaagaggTTGAAGGCcgccttggcgtcctccaTGGTGAAGAAAGCTTTGCGTGGCATGGCGTGAGCAGTGAAGGCACAGACGGAGTGGTGGCCTGGAGTT
TGttgtggaggaggtggtggagttgAGCGGAAGCTGGCAAATCCGGAAGTGAGGTGGAAGCTTCGatgtggtggcggcggaTCGAAGAGCGGCACGGGGT
CGTGTAGGCGTGATACCGAAGAAGGAGCATGCATGTACNACACGCGACTGCATGAACACAACCTCAATCTTAAGAGGTTGTAAGAGGCATTGAAGTTCCG
GCGATATAGCATTTGTGAAAGTATTGATCCTTTGCTTTGAGGGTCAATAGGATTTGCCGCCAAAAGAGTCGGAGTCCTGCTGGAGGCAAGATAAAGGACT
AACTTGGCGCGTCATACGCATTCTACCCTATAAAA