Description :
From Genome Similarity Track
Location :
Scaffold_1581:79- 5024
Transcript NameFunction/comments
Phyta_totarag13293hypothetical protein
Phyta_totarag13294hypothetical protein

Sequence
4945 bases(100 bases per row)
tcttgcagcgctgcgcgctgcgcttgatctcgcctgCCTTCGACAGTGCAATTTCTGGGAATAGGGTTGGATGTCCTTTCCCGTAACAAATAGTGTGAAC
ATAGGCATTTCCAAATAAGAAAGCCTGACTTATTTTGTGACCAAATGCCCATTAAAAAAGGAACTGGATAGAGGTACCAAACAAGAAGAGGCCACTATTA
GCATACCTACTGTACTTCACGGTAATTTACCGAGCAAGAATAAATTTCCGAAATATGAATTTCAAAAATGACCGTGTCACCCCGTCCTTCACAGCACATC
CATTCTTGACACACACTATTTTGGAGATCAGTCATTTTTAATTCGAGGTGCTAGGCGAAGCATTCGACGAAGTACGGCGGCAGACGCCGCCCACCCAAGA
AACGATGTGAAGGCGGAGAGGAGTGGGCGCCTTCCGTTGAAGTGAACACGGAGAAGACAGACAACCCAAATACCACGGAGACGACAGAGGCCACGAAGAC
CATGGAGGCCACAGAGAAAACGAAGACCACGGAAGCCACGAAGACCAAGCGGCCAAGTCCACGGAGGCGACGGGGATGACATCGACCGCGGAGACGACGG
AACAACGGAAATGATAAAGACCACAGAGGTAGAGAAGACCACGGAGGTAGAGGAGACTGGTTTGGTGCCTCTAGGCACATACACTGTCAAAGTGCGTTTA
GGTACGTTTTTTTGGTGGCTTCTATGCTCGTTTATATGCGGCCTGTTTGGTGCCTATATCATTGATCCAAGTTTGTTTAGGGCCGTGCATGCAAATAGGA
TGTAATAAAATCAAAACGGAGGTTTAGTTTGCATGAATAGCTTATGGAAGCGCCTGAGCAATATGCACTTACTACAGTAGTATTGTTCCTTTCTGTCTTT
TTGCAGGCTCTTCGCCGGACTTCAAATGTAGTTTATAAGTCCTCCGGAGGACTTTAATCTGAGGATTTGAAATTTAAATCGTCGAGTGTAGGGCTAACCG
TTGCTATCCCTGAAGGCTGAGCTGTAGAAATGTGGATTCTCATGTGTAGATAATGAGTTCGTATCAGCGTGTGTCATACGCGTTTCGGCCCCCGCCGGGG
CCTCGTCAGTGGTTTTCCAATAGCGAAGTGAGAGCTCGCCTACCTGTCGTATATCGACTGCCTTCCTGGTTCTACGACCTTCTAGAACATCCTAAACTAA
CCTAGTTTAACCCCTAACTTGTGTCCACCTCGTACATAACTCTGGAGTCGCTCATCATGGCTACAGCCACTTCCAACATGAGCAAGTACTTGGCTGGTAG
TCCTAGCAAATGAAGGAATGAAATACAGAGCTCCATTAACgtaccaccacgtcgctgatCTAGTTAGCGAGCGATAACATGTCTCAGCGCTTTCCATTTT
CACTTGTATCGCCCACGTAGGGATTCTATAGGTAGTATCACGAAGGGCTTCTTTTTTAAGCAGGTACTTACTTGCGAAAGTGCGTTTTCTTTCTGAAAAC
CTCGATTGGCCACTTTCCAATCGGCCTTTTCCAACTCCTACGGAGGCGCTTCCGGGTTGACTAATTCCCACTTCTTCACGGCTAATTCGGTGCACTTACC
CTAACCCGTTTTTGGAAAAAGGTAGTTTTTCAAACCCGATCGGCCAAAAGActtgaaaggcacaataaacagataatacatgtaccttgtATGCTTGTCG
TGAAATGATCCATTTCGCGAAGCATCGACGACATACAAATCGACAAACAAACATTGGGCTTCTTGTTACACGTCGCACTTGGTCACTGCTACACCGGTGA
TATTAACTGATACTTAGTTCTCATTTCTCTTTCTTGATTAATCGCTGGGTTTGCTCTCCTCGACCATCTTGTACTAGTGGACCAATCGCGCAACCTTCGA
GGCACACGTCAACTTTCCTTACAGTCAAGTGACATGTTCGATATGCGTTTGTAGACACCAGTTTATTTCTAGACACTTCCTAGCGTAATATATTTGGTAA
TATAACCGTTTGTACACGTGTTTGGTGCCACTAGGCACATAGTTTACCAAAGTGCCTTCAGGTACTCAGGTTAATTTTGTTTGGCGGTTTTTACTCGCTT
AAGTGCGAACTGTTTGGTGCCTCTATCATTGATCTTAAAAATAATGCTTTATCACTTGTGATACATTGCAGTTAAAACCATCATAGTGCTTCCGTCGTCC
ATTTACGTCATCGATTGACTTCCTCTTGGCTTTACACCATTTCAAGAGAAGTCAACATTCAAATTGAGAACCgccaaaatcaaattgagaaaaCCAGTAT
AATCTTATACCTCGGAGCACGGGTAACCTTTCAGAACTAGTAGGTGTCGCATTATGCACAGACTGTTGCATTATACATTGACGAgccctcctcctcgtct
tccgGCTCAAcgtcatctcctccgtcttcaccgGACGCGACCGGTGGGGACCGGATCGCGCCGTTCTTTTCGCCCGCGATCCCGCCCGTGCAGGATCGGT
CCGAGTGGGGTTGTCCTAATTACGCGCCATGGTCGACATCTCTTGGCTCCCTTACCCTGATGTCGATCTCGGTTCGCACGGTACGGCGGGTATATCTACC
CCCGCTCAATTGGATTTTTCTTTCGCCGGCGTCTCCCGTTCCTGCGTCGTGGAACTCCGGATTGGTGACGCTCGCCAATGTCGAGGCGCTATATGCGACC
CGGCCTTGGGCCTACCTGGCGCAGCGCGTGGAGTCACTCACGTTCGCGTCTGGGGACGCGTCTTTTCAGGCGTTCCTAGCGCGTTACGACACGCACTTGG
ACCACTGAGCCCAGGCGTAGTGGGAGTCCACGCACGAGTTGGTCGTGCCCGGCGGCTCGGCTTGGGATGCctggcatcgtcgtcggaaCTCTCGTCGGTC
GCACGCGGGTGACCACTGGACGAGTGTGCTGCACCTCGTACTGCAGCTGTTCGGGCGCGGGCTGGCGGACATGGACCTGCTCTTGGCCCCCTTGATTCTC
CACTTTCCGCCGGCGCGCTCGAACGTGGGTCGATGGTACCCAGGCCTCGAGCATCAGTCGCTGCAGGGGGCGCTGGACGATATCGACGCTCGCGAGCCGT
GGCGCCGTTTCTTCCGCACCCCGTTGGATGCGAACCAGCGCTGCACGGTGACGCGTGACTACCCTGCCTACTCTATTCCGCGTATCACCGGCAAGTTCAT
CGAAAATCTAGGTGCCTTTCGTAGTGTGCATGTCGCAGTCGTAGCCTCTTAATTCAATACATGACGTTCGTTCGTAGAAAgtgtcttctccgtcgcaTCT
TGATCGGTGCGGGCACCGTCGGACTTGAACCTTCGATCGTTGGCACTCACGCCACCCGCATGGCGCATAAGTGGCGCGGTTACTCGCTCTACTTTAGGAC
CCCAGTTGGCCCTGTCCTTCCTTTTTTTCCACAATTTCCTTATGAGACGACCCTCCGTCGTCTCATCTTCAGCCCGACTGGCTGGTCCTCCAGACTTCCC
TCAACCGTTACCTCTCGCTCCGGCCATTCCCCGAGCAAAAATCCCCACCATTCCTCCTATAAGCAGTCGTCCTGCTGACTTCCGCCGCGCCTTCCCAAAG
CGCTCACCCACCAGGATCATGCCCGGTCATTTCTGCGTTTTCGTGCGACTGCATGACTTGTAACCGGTTCTGCCCAGTACGCTGTCGTAAGAAATCATAC
AGCAGTCCTCCGTAATTGAGATCCAACTCATCGACCCATGTCGTCTCATGAGTTCCTTTCCATTTGACTTCAAATTCACGTCGCGTCCGACCGTATCGGG
TGGCCTGTCCATCTCGCACGTCCAGTATCCGTTCGACCTCGAACACGTCCTCTCCTAACTCCCCCGCTTCCCAGCTATCCTCCGGGAGGATCTCTTCGTA
AAAATCGAATTGTGCGTCAGCAGCCACCGTCAGTCGCGCTTCAGGACGCGTCGGGAACTTCCGGACGGCCTTCAGCTTGGAGATATGTACAATcgggtac
aactggtacgACGTGCTGTTCATCTCGAGACGCGCGGCATACGTGTTCACCATCTCAGCGACTCGGAACGGGCCGTGCCACAGGTGTGCCAGCTTGCGAG
CATACCCCGGTTTCATGCGATCCAGGTAGAGCCACACTCGTGAGCCGGCTTCGATCGGGTGTTCCGTTGCGATCTCGTTCTGGAGTCGGGCCCTCGCGTC
GACTGTGTCTTGGACTAAATCTAACGTTTGTGCTCGCGCAATCTTGTAGTGCCGTTGGATGCGTAATCTCCAACGCTTGGCCTCCACGTCGCGATGTGAC
GTATTACCGATAGCCAGTGACGCTTCCAGCGTAGTGCGCGGATCCCAACCGTGCACGAGATAAAACGGGGCCTCGTTTCTCGTACGATCGTGTGCCGTGT
TGAGCGCGAAGGTAAGTCTCTCCGCATACTCATCCCAGTCTCGCTGATTGATGTCCGCGATGTACATCTTAATGGCCCTCGTGATCGTTTGCACCATACG
TTCTGCAGCGCCGTTGGCTTGGGGCCTATATGCGAGCGTGGCTCGCTGCCTCTGGTCCATGAGTTTGCTGAACGCCTTGAAGAAATCGGACATGAAGCCC
GGCTCACGGTCGTGTCGAATCGCTTAGCTCGCGCCGAATCGTCTGAAGACGGCCTCTTCGTATGCTTCCGCAACTGCCTGCGCGGTCCGTGACGTATTCG
CCTTCACGATAACGAAGCCTGTAAACAGGTCGACccacacgagcagctcggtgTTGCCCTTGTATGACGCTGGCAAAGACGGGATGTGGTCCATGGCCAC
GACTTGGAACGGATACGTCGCCACGATGTTGCCCGGCGAGTCGCCTTGAATTGTCGGTCTCCCCTTTCCGGTTTCGCAGTCCGTGCATTCGCCCGCGAAA
CGTTGTACGCTCCTGAAAATCCCGGGCCAATGGAAATGGCGTCGC