Description :
From Genome Similarity Track
Location :
Scaffold_2167:79- 4543
Transcript NameFunction/comments
Phypl_g14767hypothetical protein

Sequence
4464 bases(100 bases per row)
CTTCCGCACCCGTTGCGCGATAGGCCTGGCATCACCTACGTCGATATCACATACAACGCCTCTGGCGGCTGGCGGCAACGCATTGCCCTTGCCGATCAGG
AGGTGTCGCCACTTCCAGGTCATTCGACGTAGCCGATCGATCTCCTCAGGGGTATTACACTTCAGATCTCCCACTTGAATATCTTCGATCGTCACTTCGT
CCGTCGTGTTGGCGCTAAGTTCCGGAAGCACAGCCAGCTGTCCTTCGACATCTTCGGCCAGTAAGTCGCTTCCTTCATGATAGAAGATCGATCCATCACC
TGACGGGTCCTCTGTTCCGACACGTTTTTGATCTGGTCGCCCCTTTCGTATTTCTTGATCAGGTCGGTCCTTTCTCACAGTGTGGTCTTGAATTGAGTCT
TGATCCAGATCCGTGACGTCGGGACCCGCTCGCGGCATGCCGGTATCAGGACCTTGATCAGACGAGAGCGGGTTTGCGTCTAACGGCGAGACGACCCTTT
CGTCTTCCGATTTTGATCCCagccgtccttcttggaTCTCTTCTGCTTCGATCTCTTCTATGGACTCTCCAGTCGGATTGTTCGCCTGAGTGTCGGTGCC
TGATCGGACGTTCTCTTCTGGATCCCGAGTCAGGTTGACCGACATCACCCGTGGGGATTCCAACGCCTTCTCTGCTCCATTAACAGGATCGGGTATCGTA
ACACCTGACCGATCCTCGAACCCGACTGGAGCAGAAGATCCGCACTCATCCTTGATCGGTGCATCCCTTCGCAATATCGCCCGCGGTATGGAATACACTG
GGCGCTCCACTGCCGGTCCAGGATCAGGTAGGTCTGCCTCCGGGGGAACGGCCTCTACCGTCGCTTGGAAAGCCAGATTCTGCCATTCATTATAGCGACG
CGACCCGATTGAGACGAACCCTGGTAGACGGGGAACCCGATCTCCAGCTAGCCACATCGCGATCCGTAATCCTGTTGGAGGATGAGGCGGCGATCACTGA
CATTCATGATCCGCAGGTATCGGCGTCTTCCGGGTCCTCCCATCGCCGTCGGCACCCAGCGATCTCCGCGTGTAGCCCATAATTTCTCTCGACCGGATAA
CGCACGTAAACGTATAGGAAGTTCACACGATTCCCCGATCTCTATCTGGAGATGCCCACCTATCGTCACCAGCTGGACTCGATCATTGTAAAGCTGCCGT
CGACCACTGAGTTGGATCTTGATCTCGTCTGGTAGGCAGATTGATCCATCTGCCAGATCGAGTCTGATCCCAGTGGGGACCATGAAATCCATCCCCAGAA
TCGAGTCTTGACCCGACAGATCACCGGCCCAAATATCGAAAAAGTAGACCAGCGATCCCGCCGGGGTGATCTTGATCTGCGTCCTTCCTTCCGTGACGTA
CACGTTTTCGCCGATCCCGATACACTCCTGACTCTGACTCCTATCGACATGGCACCCAACCTTACGAGCAAAGGCGGTGTCCACAATGGACACCTCGGCA
CCAGTAACTAAGAGTAAGATCGCCTTATCATTGTTGATCTTGCCTGTCAGCTTCGCCTGTCGAAACCACTTCCCGGGAGCATGATGTTTCCAGTAGCCTT
GGGACTCTCCTTGTAGGAGACCCAAATACATCATGACATCCGATCGGCGATATTCATCGACTTGGCGGAGATTTGAGATCACAGCAGTTCGTTTCTCATG
CAGATCACACGTATTATCGCGCAGATCTTGTTGCTGATCGCTAACTTGATCTATCGACTTCTAGTCCACAAATGCATAAATGCAGAACCTAGAACGCTCG
GCTCGTATCGGGTTCCAACCCGACGAGCGTCCTAGTTTAACATCTTCTCAGCCATTGCGGGCAACATGCCTGCATGCTTGGTAGGGTTGTACCACTGGCG
GATCTGGTTGTAGAATTCTTCCATCGGGCATTTCCCCATGTCGTGAAGCTCTCCACACCCGCGGCACACGAACAGACAGTGATCCACCGGGTGGCCTCGC
TTACCACACTTTTGGCAAGTCAAACGTTTCCAGCAGTCCAGATCCGTATAGTTACGGGAACCACAATGCGAACAGCGACTGCGATCCGATCCGTcgggag
gcagcagcgatctGCGACCATGGGGCACCTGATCTGTCGTGATCCGACCCGGTGGTAACCGATCTGCCTGGGCGATCTCGACCCCGGCCGGAGGTGGAGT
AGCTTCTGCTGACGCAAGGTAGGTCCGACGTAGATCGTCCTCTGAATCAGATCCTCCAGATCCATCCGAGCTGGAATCCGATCCCGACGGTGGATGCAAA
GACTGGATCGCGCGTACTGCTCTCTTGGCTGGGGCGGCTGACGCAGCCGCAGGGGTCTTCTGTCGATACTTGGATCCGAAGGCCGATCGTTTCTGTCTAC
TCTTCGCccgttctcgagctcggAGGACTTCTTCCAACCCGTCAGCATCCGAAAGCCGTAATAGCGTCAATTGGTCCGCCAGATCCTGATCTCCGACTGT
TTCGATGTAATGATCGACGTGCTCGCGGCGGTCCTTTCGGTCGCAGTCCTTGATCTTTAGTCGTGCACGTAGACCCGCCACGCTCAAGCGGTAGAGGTAC
TCCAGCGGTGATTCTTCCGATCGCTTGCGAGCATGATAGTACTGCCATGCGACCGAGACTCCAAGTCCGCAGTACTGGACTTGAAAGCTGTGAAGCAGAT
CGCTCCACTTGTTCCTCGTCGATCAGCTTAACTGGCGGTACCAATACTTGGCAGGTCCGGTCAGCAAGTCTGCGAAGGTCAAGCACTTCTCGTCATCCGA
GGCTTGGTCTCGCAGGAACGCCGACTTGACCTTACTGATCCATGATCTAGCACGATCTTTGTCTTGATCCTTGCCGGCAAACTCTTTTAGATCCGAGATC
GCAGAGATTCGGACACGCTGGATCAGTGAAGATCCGCTCGCTCCGCCTGATCCGGTGGCGGCGGTTGCCACCACAGCACGGCCATAGCTTGGCATATCGA
GATCATCTGGGTCGTACTCTCCATGAGATGGACGATGGTGTGGCGATCCCACCGACTCCATATCCACATCTTGAGCTCCCGCATACTTCGATCGATCTGC
CGCTTCCGGTGTGATCGTTATCTGCTGTTCTTTCAGGAACCGGGTCATGGCGGCTTGAAAGTACGTCTCGAGCTTATCCGTCGGATCCTTCAGCGTCACC
GCGTCTGTGATCTGGATAGCCGGGCTCGATGACTTCTTCTGTCGATCTGCCTTGGACGGTACACGATCGGGGGACTTCAGGCGGGATCGCAGTAGCGCTG
CACCTGAGGGTCCTAACGACATCCGTCGTGGGACGGTCGAGCTGTCCGAGTCTGGCTCTGAAGTGGCGATTCGTAGTGCGATGATCCCGTCTGGGcttcg
gtggtgctggccggTGTGGACAGCTGCCGATCCCGCATCCCAGGGGGTTCACCCACTAAGAGCTTCAGTATCTCGACCAGCTTGTGAGTTGCGGATCGGA
TTACCTCCAGATCTAGATCGAACAGATCGTCGGCATCGAACGCTCCTGCCACCAGACCAGCATCCTTGAGTAGCTCGAACAAGACCttcaccgcgtccag
cttgttcGACGTCGCCAGAGGGATCGCTACCGGACCCTTCAGATCGCCGATCAGGCGTACCTGCATGATCCTCATCACCGGATGATGGACCAGGAAATCG
CGTAGGGTCTTGTGGTGATACACGATCTCGATCGCGTCTGCCAACCACGTCGCTGAGTGTGTCACAGCCGGATCTTCCGCATCTGACTCtggcgtcttca
gcttcttcttcgcaaccttgctcttcttcttcttctgcgacgATCTCGCAGGGATAGGAGTCGTGTACACATAGGATTCAGCTTGGACCTTGTTCTCTTC
ACTCGGAGTAGCGAACGAGTAAGATTCAGGCTTGATCTTCCTGTGTTCACTAGGCAGATCTCGATTCGCATCGAGATCTGCAGGGGTCCCCGAAGGGACC
TGGGGAGGAGTTCGAGGTTTCTCTTCTAGATCCGGATCCGAATCGCCCTCATTTCTGTCAGTCGAGCTCCTCCTAGGGCTCTGCTGATCTGAGGATCTTG
TTTCattcagcgtcgtcgtcgatccgATCTCCGATGACGCTTGGTCCCCTTGTTCTTTCTTCGCTTGCGAATCTTCTTCTGCGAACTCACAGTGAAATCC
TGAGTCCCCAAGAGACCCGGGCACGCGCATCATTGTGGTGTAGCGGGATCGGCCAAAAACTTGTTAAGGCCAGATCGAGCTTCCCAACAGCGCCCAGgca
ccgactaacggagggggtccCCGATCTGCTGAACTTGTTCccaccttgtgtacccgtcggtgggCCTGATCTGCTCTCTCGGGACTCCAAAGGTTCACCG
TACAGCCCGGGTACCGTTACTCTTCTAGCCGAGTAGCCTTTGCTCTCGGTGACCCGTAAAAGGT