Description :
From Genome Similarity Track
Location :
Scaffold_3180:79- 1930
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3180-snap-gene-0.4DEAD/DEAH box RNA helicase
Pytiw_DAOMBR242034maker-piw_contig_3180-fgenesh-gene-0.0Coated vesicle membrane protein

Sequence
1851 bases(100 bases per row)
ACTGGCTCTTGCGCGAGTGCATCTCAAGCACGTTCGGGAACTTGGCCTTGACGAAGAGCTGCGCCATGAACTGCGCCGAGCGCGCCGTGGGCAGGAACAC
GAGCACCTTGTAGTCCTCGTGCTGCATGTGCTCGGCCAAGATCGTCTCGACGGCCGGGATCACGCTCGGCAGGTCGCACGTGACCACCTCCTGCACGGTT
TGCACGTTCGTCTGGTGGTCGTCCTCGTGGATCGTGTCGATGAACTCGTAGTCCGGGCGCAGCGCCACGTCCTTGAGCTCCTCGGTAGACTCGGGCAGCG
TCGCGCTGAAGAGCAGCGTCTGGCGCTGCTTGGGCAGGTTCGTGATGATCTTCATAATCTCCTTGCGGAAGCCCATGTCGAGCAGTCGGTCGGCCTCGTC
AAGCACGAGCACGCGCAGGTTGCCGAGCTTCTGGCGGATGTTGCCACTGTTCTCCTCGAGGTGCGCCTGGAGTCGGCCCGGGGTCGCGACGAGCACGTCC
AGCGGCCGCGGGTTCGAGAGCTGCTTCACGTCGCCGTTCATGGACGTGCCGCCGACGAGGCACGCGGTGCGCATGCCGTGCGCGGCCGTGAGCTTCTCGG
CCTCGACCGCGATCTGGTTGGCGAGCTCGCGCGTGGGCGAGATGACGAGCGTCGAGATCTTGGCGTCCTTGCTGGCGCCGCCGAGCTCGCGCTCCTTGAG
CATGTTCTCGATGCTCGGCAGCAGGAACGCGATGGTCTTGCCGTTGCCCGTCTTGCCCTTGGCGAGCACGTCCTTGCCCTTGAGGATGTGCGGGATCGTC
TCGTTCTGCACGTGCGTGAGGAACTCGTACTTCATCTGCTCCGTGAGCACCTTCTTGGAGCGCTCCGAGATCGCGAGCGACTCGAAGGACGTCTGCGTGA
GGTACTGCAGCGTCTGCGTCGAGTGCACGCCGCGCACAGCGGCAAAGCGCTGCTGGGACACGAGCGCCGCCGCGCGTCTGTGGGTCGAGAGCTTGGAGAG
CCACATCGCTGCTGGTGAGTTGAGTGAGCGTGCGAGAGGTGGTGGATCGCAGACTTAAGCAGCTCCTTGTTGTTGCGCAACAGCGCGGCTCTTCCTGACC
AAGCGACTGTATCACATCAAAACATCTTCAACTTTGTATGCAATAATATCGTACCTTGAAAGTGGATGTCATAGACGACCTGATTGTCAGTGGCGTTACG
TTCTGTAATGACATAGTATCGTAAGGTACGGGTTGCGATTACGTTCGTATGTGACATCAAGACTACGGTACAGAATGCGACAACAATTGCGTTACGGTCG
TTTACGACATCGTTAGTACAGTATAAATATTGTGACTTGATTTTACTATGCGACCCGCTCTATCTTTTCAGACCGAACAAAGATCACATTTTCTGGATTG
AGTACGAGTAAAAAAGCTCACACCTGTGCGTGTGCATCCCCTCCCTCGCGGCCCTCTACGACCAGCAGCAAGCAGGAAAACAGCAATAAACGACAGCAAA
CGATGGTGACGCGCTCGATCTTCTCGTCGGGCCTCGCACTGCTCGCGATGGCGGCGGTGGCGCTCGTACCGCATAGCGCGGATGCCTTCATCGTCGAGCT
GGGCGCCAGCTCGCAGGAGTGCTACTACGAGTACGTGCGCACGAAGCGCACGGCGTTCCTCAAGATCGGCGTGCTTGAGTCGCAGGACCAGTACGACATC
CGCCTCAAGGCCTACGGCCCGTTCTCGGAACCGCCCACGGAGGAGGACATGAGCATGGGCTTCTTCGACCAGATGGTCACGACCCAGCGCGACCAGAGCA
ATGACGTGCAGCACAACGGCTTTAACTTTGAGTCCGAGCACCGCGGCGGGT