Description :
From Genome Similarity Track
Location :
Scaffold_3346:79- 1797
Transcript NameFunction/comments
Phypl_g15777hypothetical protein PHYSODRAFT_332751

Sequence
1718 bases(100 bases per row)
TGGCAGGTCCGGTCAGCAAGTCTGCGAAGGTCAAGCACTTCTCGTCATCCGAGGCTTGGTCTCGCAGGAACGCCGACTTGACCTTACTGATCCATGATCT
AGCACGATCTTTGTCTTGATCCTTGCCGGCAAACTCTTTTAGATCCGAGATCGCAGAGATTCGGACACGCTGGATCAGTGAAGATCCGCTCGCTCCGCCT
GATCCGGTGGCGGCGGTTGCCACCACAGCACGGCCATAGCTTGGCATATCGAGATCATCTGGGTCGTACTCTCCATGAGATGGACGATGGTGTGGCGATC
CCACCGACTCCATATCCACATCTTGAGCTCCCGCATACTTCGATCGATCTGCCGCTTCCGGTGTGATCGTTATCTGCTGTTCTTTCAGGAACCGGGTCAT
GGCGGCTTGAAAGTACGTCTCGAGCTTATCCGTCGGATCCTTCAGCGTCACCGCGTCTGTGATCTGGATAGCCGGGCTCGATGACTTCTTCTGTCGATCT
GCCTTGGACGGTACACGATCGGGGGACTTCAGGCGGGATCGCAGTAGCGCTGCACCTGAGGGTCCTAACGACATCCGTCGTGGGACGGTCGAGCTGTCCG
AGTCTGGCTCTGAAGTGGCGATTCGTAGTGCGATGATCCCGTCTGGGcttcggtggtgctggccggTGTGGACAGCTGCCGATCCCGCATCCCAGGGGGT
TCACCCACTAAGAGCTTCAGTATCTCGACCAGCTTGTGAGTTGCGGATCGGATTACCTCCAGATCTAGATCGAACAGATCGTCGGCATCGAACGCTCCTG
CCACCAGACCAGCATCCTTGAGTAGCTCGAACAAGACCttcaccgcgtccagcttgttcGACGTCGCCAGAGGGATCGCTACCGGACCCTTCAGATCGCC
GATCAGGCGTACCTGCATGATCCTCATCACCGGATGATGGACCAGGAAATCGCGTAGGGTCTTGTGGTGATACACGATCTCGATCGCGTCTGCCAACCAC
GTCGCTGAGTGTGTCACAGCCGGATCTTCCGCATCTGACTCtggcgtcttcagcttcttcttcgcaaccttgctcttcttcttcttctgcgacgATCTCG
CAGGGATAGGAGTCGTGTACACATAGGATTCAGCTTGGACCTTGTTCTCTTCACTCGGAGTAGCGAACGAGTAAGATTCAGGCTTGATCTTCCTGTGTTC
ACTAGGCAGATCTCGATTCGCATCGAGATCTGCAGGGGTCCCCGAAGGGACCTGGGGAGGAGTTCGAGGTTTCTCTTCTAGATCCGGATCCGAATCGCCC
TCATTTCTGTCAGTCGAGCTCCTCCTAGGGCTCTGCTGATCTGAGGATCTTGTTTCattcagcgtcgtcgtcgatccgATCTCCGATGACGCTTGGTCCC
CTTGTTCTTTCTTCGCTTGCGAATCTTCTTCTGCGAACTCACAGTGAAATCCTGAGTCCCCAAGAGACCCGGGCACGCGCATCATTGTGGTGTAGCGGGA
TCGGCCAAAAACTTGTTAAGGCCAGATCGAGCTTCCCAACAGCGCCCAGgcaccgactaacggagggggtccCCGATCTGCTGAACTTGTTCccaccttg
tgtacccgtcggtgggCCTGATCTGCTCTCTCGGGACTCCAAAGGTTCACCGTACAGCCCGGGTACCGTTACTCTTCTAGCCGAGTAGCCTTTGCTCTCG
GTGACCCGTAAAAGCGCA