Description :
From Genome Similarity Track
Location :
Scaffold_4169:79- 1442
Sequence
1363 bases(100 bases per row)
GATCCCTCTGCAGGATCTATCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAAC
CATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAG
GTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTTCATGTTCCGCCCACTTTAACCGGTCTGGCAGCTCCCAATTTTCCCCGGGCTCGATCCAGGTGGT
CTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCC
AGATTTAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAAC
AACCTGCCAGCTCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTA
CGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGA
ACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAG
ACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGT
AGATCCAGGGTTGAGGAAGACTTCGGATTCGGCCAAACTAATCCCCTGGGCCCAACCTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATT
ATCGACGGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAA
CCCGGCGAGCGTCCTACTTTAACATCTTCTCGGCCACTACTGGCAATATCCCTCTGTGCTTGGCAGGATCAAACCATTGGCGCATCGGGTTGTAGAATTC
CTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAATG