Description :
From Genome Similarity Track
Location :
Scaffold_1:78989- 80478
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_00040Hypothetical protein
Sappa_CBS223.65SPRG_00041Hypothetical protein

Sequence
1489 bases(100 bases per row)
ATCGCAGGAAATAAATAGAGTGCGCTAAGACATGGCTACACGATGCGGTAGGGCGGAAGGCGCACGACGGACCGCCGGACAGGCACTGGCTTGTACGCGT
CTTGCATCGCGTGCACAGCCACTGGGAGGCTCTGGACGAGGCCGACGACGAAGAGCACAACGAAGAGCGGGATGAAGAAGATCGGGTCGACGGTCTCTGC
CGCCAGCGCAATCGCCTTGTACCTAGCACATACTACCGTGGTGCCATGGTCCCAATAAGATCTCATGCGTACGCAAGGATGGCGCCGACGAGCATAAGAC
TTGCGGCTTTGAGGATCGAGAGCACGCTTGCCATCGCCGCTGCTATTTGTTTTTTGAGCAACAAGATCCCGCGCGCGCGGCTGTATCCCGCACGCGATGA
GGTGCTGTACATTTGGTTACAAATCGCCAATGTAAGAGCAGACGACGTCATGGAGGAGGTGCTGCGAGTCTGGTCGTCGGGCCAAAGCCCCGCACGCGCT
ATAATAGTCACGGGGCACTTTCTACACTCAACGACGCTGGCTGCACCATGAGGATGGACCTGCTCGCACTCGTCGTCGCTACAGGCACCTCTAAGCGCAG
GGAACTGAGTGTAGTTTTGACACTCAACGGCAAACGGCAAACTCGAGAAGCGTCCTGGGACATGCGATGAAGTCGGAGGTGTCCCAACGTTCTTCGATTG
GAGCTACAAAGTTTGTACTAGTACCGCATGGATACCTCGTAGCCATAAAAGTGAATAAAAGTGGAGGGATGGCCAGTCCACGGAGAATCTTGGCGCGTGC
GCGGGATCGCAAGCGTCAAGGGGATCGGGAGCGCTTGTACATCCAGCGCAAACTATGGATGGTGGAGCGACCAGCCATCGCTTACCGCGTTTGGATCGTG
GAGTTGGACTACCGGTACAAATTGTATAGGTAAGACAATCAATCAATCAATCAATTATCAAACGTGTTCGCGTTGAATTCAAATGAGCAAAACTAATAAC
TGGACGATAAGACACTCAATACAATTACATTGGGTTAAATGGCGTACTCGCGCGGGTCGTAGTCGTCCTCCTTCCACTGCCCATTGTGCGGCTGGTTGTT
GTTGTTGTTGCTGAGGTTTTTGAGCTTGCCGTTGTTATTGTGGTTGCTGGTTTTCTGGGGAAAGCGCGGCTTGTCGTCGCTCGCGCGGTGGCTCTCGCTC
GTCCACTCGCGCTGCTTCTGGCTCGTGTCGCGGTGGTTGGTGCTGTTGGTCGCCATCGCATACGCGCCGGGGGCCGTGATCGCGTCGAGCGCATAGAGGT
CTTCGCCGCGCATCGTGTCGTTGGAGGCCGCGAGCTCCTTCTTGAGCTGGTGCGTCTTGTAGAAAATGTAGATCTGCCGCGCGAGGAGGCAGAGGAGGAC
GCCGAGCTGCAGCGCAAGGATGCCGTACGAGATCGCATTCGTGATCTTCTCGTCGGCGCCAACCGTCGCGACTTTGAGGAGGAGGAAGC