Description :
From Genome Similarity Track
Location :
Scaffold_804:7898- 8963
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_804-fgenesh-gene-0.126S proteasome non-ATPase regulatory subunit 7

Sequence
1065 bases(100 bases per row)
CGTGGTTCTCCTTGATCACAATGTCCCTGCCCAGTGCGAGCCACGGGTACTGGATCCAGATCCACCGCTGGTAGTAGTAGAACCAGTTGCCGTTGCTTTC
CTTGTCCTTCTGGATGACGTTCGCGGTTGCCTGCTGCGTCAGTGTGGGAAAAGCATCAAGTGCGGCGTTCAGTGCCGACGCCGCGGTCGCTGCCGCCGAC
ATGGCCATGGGCGAGGCCGCCGTATTCAAATGGAGCAGAGCACCCGACGCTGCGGCGCTCGACAGCGACGTCGTGAGGTGGTGGACATGCGGCAGGTCTT
CGGCAAAGAGGAAGCCGTCAGCGTGGAGCTTTTTGAGATCAAACGTCGAGTGGTTAAAGACGGGGAGGAACCCCTGGTACGACGTGGAAAACTCAAACAT
GAACTTGGTCACGAGCTGCAGCATCGCCGTGAAGACCTTGGTGGTCGGCTTGGCGGCTTTGTACCAGTCCTCGACGCTCTTGCCATACTCTTTGACGACG
TCAAAGGCGACCGCGTAGGTTAATTGTTCGCAGCTCGTCGCGTCCGTGACACTATAGCGAGGCAGTGGACCGTCCATGAGGAGCTTCCAGTACCCGAACA
GCTCGTTCTTGTAGTTGGCCGTGTACAGCAACTGAAACATGGGTAGATTCACCAGCACGTTGCGCAGCGTATCCCACTGGTAGCAGCGCTTTAAGTGCCA
TGGTAGTTCTTCGACGCGACGGAACGTCGTTGGGTGGATGCGGAAGAATCGAATGAGCCACTGGTGGTACTGCTGCTCGGCACGCTCACTGCCAATGTAC
CGCCACCACACAACGTCGCGGAGACTCTCTTTGCACGTCGGCAGCATCAGCACGTCCTGTACTGAGAGGATACCAAGCGGCTTGAGGGCGCGCAGCAACG
CCTTCCACTCAGCGTCGGAAAATGCCGTTGGATTCTCAGTCGAGAGGTTCTTGACGTTGCTAAACGACGCCTTGCGGTGCAGCTTCGTCGTTGACTCGGC
CAGTTGGCGTTCCTCAGTGACTACGGCGTTGAGAATGAACTTGAGCTCTTTCTCGAGGAGGCCGT