Description :
From Genome Similarity Track
Location :
Scaffold_620:7898- 8938
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_620-snap-gene-0.11Isoform 4 of Protein CLEC16A
Pytiw_DAOMBR242034maker-piw_contig_620-fgenesh-gene-0.4RNA helicase

Sequence
1040 bases(100 bases per row)
GGTCGTCGTCGTGCGCTCAAACTCGAGCGCTTCGAGCGAGTCCTGAGGTAGTGATGATGGTGAGACTGCCTGCGATGGAGAGGCGTCATTGCCAGTATCG
TCGGGGCCGTGGTTCTGGTCCGAGTAGATGAGGAACTCGGAGAGCACGCGCAGGAGCTCGACGATCTCGGCGTCGCCCAGCTCCGCGAAGCGCAGTAGCT
GCGCGTGCAGGTGGCGCATGCTGGCAATCGTGAACTCGCGCGGCCGCGAGAAGATGCTGCTGAGGCGCTTGCCACTGCCGCCACCATTGCCACCCGTGAG
CCAGCCCCACATCGTCTTCTATCTAATGAGCAGCTCTTTTTGGCACAAAAACGAACCCAGAGAAGGGCGGAAAAGAGTACAGTGGAGGCTCTGTTATTAC
ATACTCTGTAGCATGTAATAAGAGAGAATGTACTGTACCTGATTGGTTTTCCTTGATTTTGGAGGTCATCGAATACAAATCGATGGTAGATGGTGAAGGG
TGATCTTGTTTTTTTACTAGAGCAGCGCAGTCCAGCGCGCGTAGCACTCCTCTTCCCATGTGAACAGGAGCGAGCGTGACTTGGCTTCACTATCAGTGTC
TTGCTTCCGACTGGAGGTTGAAATCGCAGGCGCCCCGACAGAATTCAGAGTCCGAGTGAACTCTGGAGTTGAAGTTGTCACTTCTGTCGCGAAGTCCTTG
GTGTTGAATCGTGTTGCAGATGGCGCCACTGAGAATTGCGTTACGACGGGAGTTGCTCTCTGCTGGGACTCTGGCTCTTGTGTGACACTCGACACCTTGT
GTCCATTGGTTGTCTGAACGTCTAAAAGTGGTCGTGTCGCTGCAGGTGAAGTCGCTGCCTTGGAGACTAGAAGAGCAGGAGTGATCGCCTTCTTCTCCAC
CGTCAGCTTTGAGAATCTCTCTATAGGCTCGTCCTGCTCATCGTATTTGTCATTCCGCAGCGGCACTGCCGTCGAAATCTCAGGCTCTCGCACCACCGGT
CCAACATCTTCGCTCCTCGTCACAGTTTTCCCCTTGACAA