Description :
From Genome Similarity Track
Location :
scaffold_260:7897- 9880
Transcript NameFunction/comments
Pl_106911hypothetical protein PHYSODRAFT_264390

Sequence
1983 bases(100 bases per row)
ATCGACTGTAAATTCACTACGGCGCTCATGGTGCGCTACGGCATCATTTGTGTAAGCTACGGAAACACGACCACCATGGCTTGCATTCATGGGTGGTTTG
CCATTTCTGGTAAACAGCTGAGTGCTGCCTTGGGGGAGGCTGTAATACAAAAGTGCACTTTCGTAAAAGTGTAGATCCTCCCTAACTCAAACTCCCACTG
GTCACATGGCGTTCGCTTCTTAGGCTTCCAAAGAGTCAAAACAAAAACGTGCTTGCTACGGCGTTCCGGATCCAATTTGGCTAGCAAAGCGCTAATCTGT
TCGATTGGGGCAGCAGAGTACTTGCCAGACATCAGCTCAATACGAAAGAGCGTATCTGTCTCTTTCACCGAAACCACGCACATCTCCAAGCTCACATTGA
TATCTGATGAAGGGTTGTCGCCCAATCCGACAATAAAATCGCGAGCCTCAGCAGGAGAACGAAGCGGAGGGAGACTCTCCTCTTGTTCTTGGTCAGCCAG
CTCAGCTTCCAGAGCACTCATTAGGCTCGTCTCTGACATTTTCAACAATGACAGCGGTGATTTTTAACAATGAACCACCCTAGCCTGCGTTCAGCCGTAT
TCGATGATGTTCGTTGCGTGTATAGAGCATCCTTGGCAATGCCTTGGTGTCATCGAGCAGATCCGAACTTTCTTAGCCACTATGGAATACCTGCATTGCA
TAATTGTATACCATATTGAGATCTCATCCGTTATTTTTGCAAAATTCCAGCACGAAATTGATGTCTGCTGTCTACCTGGCAAAACCAACGGAACCCACCT
CTCTCCTAAGCTAGAAGGCGCCACATCAACCGGGTTCAGTCGAATTCGATGTTGTTCGCTTCCGATAATAACATGGTAAGACCATCCTTCAAAATCCGTT
GAATGCTGTAGCAACCCACGCAATTATATGCTTCACACCACTTCAATGTTTGTGGCTACCTGTAGGACAAATCGCATGTTCTCAAGAAAATTAGAGGCGC
CATATGATTCGCCCAGATTTCAACACCGAGTTCGACGATATTCGCCCACCATTAACTAGCCGACAAACAGTATCTTGCCAAATTTTAGCACTGAATTCGA
TGTTATTCGCATGGATTGTAAACTACTTGACAGCCCGATCCTTGGTACCTAAAAGAAGCATTTCCTACATCACATCGAATAGGTGGGCACTCAGCGTAAT
CGAAGAACTTGGTGAAGTATAGTTAAATCCCCGATATGCACCTCAATCACGTTTCACCACACAGCAGTTCTATTTACCACATAGAACTTCACCAAACTCA
GCTAACGAACTTTTATTGTAATATCTAACGAGTCCTTTGGCAATAAAAAACGTACAGAGCTCAACAGCCAGTCAAGCCATACATGCTCGGCGGATGCATC
AAGCACCAACACCTCCAGGTCACGCACGATGGATAAACCGTATTTAGTGAGCATCAGACCTATACTTCACCTACGCATCGCTCCTCAAGAGTACATGCTC
AGTGTCGGGAGTGTTGTCAACTTGAGATAACGAAGACTCTCAATACTCATGACATTTTACTTGTGTGCTAGTACTAAACCTAGCTTGTTTGTGCGTCGAA
CTTGTGTACAAATTCAGTTCAGGATTAATCTATCAAATTTATCTTAGATCAAATGAAGTTGTGGTTTAAAACAATAGACCTGCATTCTGTAGGAGACCAT
CACACACTCTGTTAATCACTCCTTATTGACGACCATCACTCCTGTTCTCGATATTTAGAGTAAATGAGCGGAGCATCGCAATCAACGTCATACAGTGTTC
AAAACAAACCACAGTACTGTGTACCGTGAATTACGTTCATCGTCGCTAAATAAGTGAGGATTCAAAAATCGAAGTCATTTAGTTTTAGAGGATTTTCCGT
GAACAGTCGCTACAATAGTTAAAATAAGATAAAATGGAGGGAGTTTAAAAATTCTGTCTAAATTTCAAATCAAACAGGTAGCG