Description :
From Genome Similarity Track
Location :
Scaffold_1050:7897- 9862
Sequence
1965 bases(100 bases per row)
GAATCGGCAACACATTCGAACCCAAAGGTCGTCGTTCATCCAGCGATGATACTTACAGTCCTTCGGCATCCTTGACTACTACTTCACCTAGTGACCATAC
ACCGATAATATACTCCGCTGCGTTTGCATTGCAGCGCGATGGCCTAGAAGAGAACGATCTGTTGAAATATGCATCTTAATATAGTTCGCTCAGTAACGCT
GAAGATGGTGAAAGGGATTACGAGGATAGTGACGACATGGATCATGAGAACGTAATTGAGGAGAAAATTGCTACGAGCGATATTGTGGACACAACACATG
AAGATTTCAATTTATCACGTGATGAACAGGAAACCCTGCTATACGACTTTGATTTTCCTGATTACAATCTGGATATCGACTCACATACTCTTAGTGGCGA
AGACGAACTAGAATGGATTGGTGACACTCTACTATACTTGGTATGCGAGCGTCAACtggaccaagaagagatACCACGACACCAAACTCAAATTGCTTGA
AGGTCCATTTCACTGCAAAACGATACTGAGGACATCAATGAGAGCGAAACTTACACTGACGAAATTTTTATTATTCCACCGCCTTCAGAAGTAATTTATG
ACTCTCACGATGAGGCAGAAGCCGCGATACATGCATGAGCTTGGAGTACAAGTGCAACGTGTCGCGTCTTAGAGTTAGGTACCTGACAGTTATAAAACCA
ATCTGGGCTCGCAACTACGAATGCGATTGTGCTGGGTGGCCAAAATACACACAGCATTTGACTGACAGTTAAAGGCAGCGTCCGATGAGGGGATCAAAAC
GATGCGGCTGCCCAATGAGATAATTTTTTTGCGTCGTCTCCAAAACCAACACCAGTGGCCCATGGCAAATTGTCCACACGCAGCACAAAAGTGAAGTACA
CAACCATCCCGCGTCAGAAGATTTCATGAATAGgcaggcagcagcgggtATACCAGTTGCAAAAATTCGGACCTCAAGTTTGCATAACAACCCAAATTCC
CTTGTGCTTCCAAAATACATAGTCAATGTAAAGCTGAAGTCCAGGAAAACCATTATTACAACTTTGACCTGTGGAAGCTCTTTTTTCACAGCTGGATAGC
CACAAGTTCTTGTAGCGTTTCGCAGACAATCTTTCATCAAATGAATTGCTTTATCTTCTTTGGGCTCATCCGGCTACGATACGACTAAACAATACGCATT
GTCATGTTCTGATAATGGATGGCGTATCCAAGACAAACAAGTACGACTTCCCTCTTGGAAACGTGATATCTATGACTAGAATGAATACGGTAGTACCGGT
AGCACAATCTTTTCTCCCTGGTCAAATGGAGATCATTTTTTCTGGTTTCTACGGACACTCCGTGAGATGATGAAAGTGAATCATATTCAATTTCCGTCCG
TGATTCGTATAGATCGCGAACTTGTTTGTGAATGCACTTGGCACAGATTTCCCAAATCTCCCATCTATAATTTGTAGATGGCAATTGAACCAGAACGTGC
AGATGAAAGTAAGAAGTGTTCTTGGTCAAGTTCTTGTGCACAACACTCTATCATGGCAAGATAAATACGAGACCACCTGGCAGACGGAAGTATTTATGGC
ATCGTTTTACAAGGCCGTGGAATCCACGACAGAGAAAGAATTTAAGTTACAGAGTGCTGTGTTGCAAAATTTGTCGCCAATGCTAGCATCGTACTTGGAG
GAGTATTGGTGGAAGTATAAAACTAGGATCGTTCATTGTTGGACTACCCAGTACAAACACTTTTCTTATCGAGACACGTCTGCAGTTGAGGGGACGCGCG
CTCAATGCAAACGCTGGCTACAGGATTTGTAACGGAGATCTTTACACTGTTTTCAACCGGTTGTTGCCCTGATGGGTTTCTGCTGCAAGTGTTGTAAGTG
AACGTGCTGCCCGGGATGCAACCATTTCTACCGTATCTCCTACAGCACGACCGATATACACACGT