Description :
From Genome Similarity Track
Location :
Scaffold_106:78957- 80030
Transcript NameFunction/comments
Hyaar_Emoy2809638GL12621

Sequence
1073 bases(100 bases per row)
TGTTGCAAACTGATGCATTCTGCTCTGACTGTTTTTGTACGGCAGTCCTTCTTGAAAGAGGTACTCAAGGAAATTTGCATCTACCACCGCAAGGGCCCTA
ACAAGAGCTGTTACGAGCTGAAGCCCCAGTACAAGGATGGCGTCTCTTCGAAAGCGTAAGTTGCATGTCATAGATAGCACGAGGCGCTCATTATAGTACA
AATAACAAGTACCGTTCTCTATTGTTCAGCCGTCTGCAAGTTCAAACGTATTATGTCAAAGTGATAATACTACTGACCTTCAAGCTGTACTTTAATTGGC
ATGTGAGCGAAAATCTACGAACATGCATTAAGAAGCACAAGAAAACTCGACAAGCAAACATGACTGACAATTTTATCAGCAGTACACAAGCATGAGCACT
GTGTGCGATCCGAAGCGGCTATGCAGCGCTCATAAGATGCAAATTTGGTACGATTATAGATACAGCGACTCTTCTCATGCGACGAAGAAGGAGACAAGAG
GACCACGTTCATCACCGCTTTTGCATTTGTCAACAACAAATCTGGTGAGTCTTTTGCACGTGAAAAGTCGTATGATCCTCAAATATAAGGAGCTCGTTGG
GTCCATATTGCTTTTGCCACAATGACCTCAAATGATGAAGAAGCGGACGAGCGGCTTGCACGTTCTTTTCCCAAAACATGTGCCACATCCGTACATAAAC
AAGTTCTAGTGATGAGCCAGAGTACGCCATTCGAGCCAGAAACTCGGTCTCTCCTTTTCATTGTGGTGCAGCTGCAGCGCGGTGACTACGGTAGTTGCAA
TAAAGTCTACTATTAATTTGTGAGAATGATGGTACAGCAAACGACCTTTGGGGTCTGCACGAAGAAAGCATCGACCGCACAACAATTGCCACGCAATTTC
CACGTGGTAAGGATTAATGCTACTGACGAAACAACGAACAGACGTTCACATCGGCGCTAGTAAGAGAAAGGCTGAAAGTTTCGAGATAATGTCTGACACG
AAGTCCACACACCTTTGCCTTGAGAATTCGTCCGCAAGAAAATTGAAGCGCTAGTTATCCATCGGATGTTCGC