Description :
From Genome Similarity Track
Location :
contig_118:78956- 82087
Sequence
3131 bases(100 bases per row)
CCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGA
CAGCACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCGTTTATACATATGGCGAATTGAATGCA
CCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACA
TGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGA
CTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGCGCGTTTGTATGGGGTAGAGGGTCCTATACACGAGAG
GACAGTATAGTGAAATCAAGACAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTC
TCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCG
AAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGG
AGTAGCTGAAAACTTGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTT
CTTTAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGAC
TTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGAC
TACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGCCGGTGCTCCGTG
TCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCC
GCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACA
GCACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTATACATATGGCGAATTGAATGCAC
CGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAACGTAGGATTCTACGTTTCAACATG
TGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAACATGGGGACT
CTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGA
CAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCT
CCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCG
AAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGG
AGTAGCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACT
TCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTAT
GGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCG
ATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGC
TCCGTGTCCTCCATTTATTGGCTCGGCTTTCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAA
ACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACC
TCGACAGCACAGCTTCATAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCATGTTTATACATATGGCGAATTG
AATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTT
TCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAGC
ATGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACA
CGAGAGGACAGTATAGTGAAATCAAGACAAA