Description :
From Genome Similarity Track
Location :
Scaffold_419:7895- 9670
Transcript NameFunction/comments
Phyta_totarag8125hypothetical protein PHYSODRAFT_336471

Sequence
1775 bases(100 bases per row)
TAGGTTAAATGATTTTTCTAATATGTTACTGGTGTTTTTTGATGATAGGTTTTTACTTGGAAATAAACAGCTGCGAGCTAAAGTGCAGGTGGACGCTCTG
GAGGGTGAGATGCAGACGACACCGCTGTTCTGGGCAGCTCTCCACAACCAAATTTACGCGGTGGAACTGCTGCTACGAAATGGTGCCGACCCAAATTTCC
GAGACGGATTGGGCTTTTCGCCGTTTTTAGTGGCAATTCATCGCTGTTTTCCCATTACGGCGGCGTATTTAGTGGCGAAGGGGACCGATGTGAATCAACG
CATGCAAGGTGAGTGAGTGCAAAAAGGAGTGTAAACTTAGTCGACGAAAAAGTCGGTAATGACGTTTCGCTGTGTTTAAATGGTTTTATTTTGTGATGAG
CAGATGCAGGCCAGAAGACGgcgttgatgttgctgtgtcAGCCGCAGCAGTTCCACTTGGATACGTTCCGGATGGTGCTGAGTCTGCAAGCTACTGTGAA
TGCACAGGACGCTGATGGCAACACTGGTACGGTTTTAGTCTTTCAGCACAATTGTTTTTAGGGGGTTTTCTAACTGGAATGGCTTGTATCTGTATGCTGA
CAGCTCTTCATCATGCGGCTATGAACAATATTGCCATGGCTGTACGGATGTTGCTCGATGTGGGAGCCGACACGACCATCGTCAATACAGAGGGCCTCAC
AGCGTTGGGAATTGCAAGTGTGAGACTTCGCTCAGACTCGTCGGCGCGCCACCTTCTCACGGAGGACGAACAGCTGCAACACCTTTCTCGATGTACTTCA
ATTCCGGTGCGTAGCAGGATGCGATGGCATTACTTGCCATTAAAAACCACTTGCTAATTTGCGGGTTGTGGCAGAAACAAACACTTGAGGACAACGTGTA
CAAGCTCGCGTTTTTCATGCCATGGGTGGTATTTCCTCTCGCGTACTACGTGATATCGACCGGGAATGGAGGGCTTTACATCATGCTGTCGCTCTCCATC
CTGTTGGTTGCAGCAATACTGCTGCTTAAATTGCTACAGCGTGGTTCCTACGGCGACAAGCGCAAAGCAGCATCACTTATGTTCGGGATCAACGTCGCGT
CGATCGGATATCTTGTTGCCAGTTTCCCTCAATTCAGTGGCTACTGCAGCACTGCGTTCTGCGCAGTTGCAGCCGTCTCTTTTGCTATGATTGGGGCCAC
GCTATACAAAACGTCCACTTCCGACCCGGGAGAGGTGTTCACGTCGTACGACGAGAAACTGCATGTAAGTTGGTTTGTGGTGTTTTATCTCTCGTCTTGG
AAGACACGAGCTAACCGGATGCCACTCTGTGTGAATGTTTCATTGTTAGAACATCCGATGGCTCGTCGAATCAAAGTTACCCAGCGCAACCAAACTGTGT
CTCACCTGCTTGCACAAAAGGCCGCTGCGTGGGAAGCATTGCGCCGAGCTGAATTCGTGCATCGCAAAGTTCGACCATTATTGCCCCTTTGTGGTGAACG
CTATCGGCGCACGCAACCACGCAGCCTTCCTGGGGTTCCTCTTTTCGGCTGTGTTATCGATTGGACTGGAGCTTGTTGCCTGCTGGCGCTTCGCGCGTGC
ACAACCTGAGCTTGTGGCAGACTTCACCGTCCAGTGGCagtggtggaagtggaacTCGTCGTTGTGGACTCTGCTCGTGGGGTCAAacactgctgcagcc
agtATCCCTGGACTAATTGACTGGCTTCGGAGCGTCGCACATTTCCAGCCAGTGCTCTTTTgcgtcatgctgctg