Description :
From Genome Similarity Track
Location :
Scaffold_1105:7895- 9599
Transcript NameFunction/comments
Phyta_totarag12056hypothetical protein PHYSODRAFT_332751

Sequence
1704 bases(100 bases per row)
ATTACTTGGCCGGCGATCCTTCAACTCTCAAACCATCAAGTCCCCGCTATTCGAAGCGGCAAGCATCAGGAGAGGAAAGGAAAAAGACAAAGGAAAGGAG
ACCCATACCCAAGGGCAACCCCACGGCGGAATCCAGATCCAGACCGCCAGATCAGAGCTTGATTTAATCGTTCTTACATCTGGGCAATTATATGGGGCAG
AGTGAAGACTTCCACGCTGTTCCACCCATCCCCgcgtctcgccaagacgttTAAGACTTCACGATCTCGCACTTCGGTAGTCACCAAGAaagcagatcca
gcccaccgacgggtacacaaggtgaccagttcagcagNTgctccgttagtcggtgtctgggcaGAGTTGGAaagccggatccagtctCAGTGAAAATTTG
AcggatcccgctacaccacaatggtgcgcgtgcccgtATTCGAACCAGGGATTTCACCGTGAGTCCCAAGAAGATGTGAAGGTGAAAGAAAACCAAGAGG
ATCAAGCGTTATCGTAGATCGGATCGACAACAACGCCGCTGAATGAAGTAGGACCCGCAGATCGGCAGAGTGCTGGGAGGAATTCTGTCGACAGAAATGA
GGGAGATCTGGCACCAGATCTAGAAGATAAACCTCAGCCTCCTCCCCAGGCCCCACCGGGGACCCCTGCAGATCTTGTTACGCATCGAGACCATCAAAAC
AACATCGGTAAGGGCAAACCCCACCCATATGTGTTCACGACGAATGAAGTGACCACAAGCCCGCTAATCGCAAGATCTAatacgaagaagaagaaagtga
agaCTACgcagaagaaaatgaagatCAGAAAGAATCGCCATCTGCTTGGACTGAGCAGGATCTGGAGATCGCGTTTCATCATAAGGCGCTACACAATTTC
TTACTCCAAGATCCAACgatgaagatcatgaagGAAAAGCAGATTGCAGTTATGAAGGGACTAGTGTCAGCTCCGCCAGAGACGCACAACAAGCCGACTG
CGGTGAAGAACCTACTTCAGGTGCTAAAAGTGGCAGGTCTAGTTGCCGGTGCTTTCGACGCTGACGGACGGTTTGATCTGGATCTAGACACCGTCAAATC
TACTTCCCAAGAGCTTTTCGCTAGACTAGCGATCTTGGTAGGCAGAAATGCCCGGATCGAAGATCCAGAGATCTTGCCCCAGATCAGCCCGACGGCGTAC
CAGACTAGCTCTTCACATTATACATCGGCAACATCAGAACCTGATTCCGATGGATCTATATGGCCGCAACGCATGCCTCTCGGACCATCCGGAGAAGCAC
TGTTGATATCTTGATCTCATAGGACGTCCTCTGATCGGACGCAGCCGCGGAAGCAGAGGCCGCTACAGAGGCACCCAAACCAGACCACGAATGTAACCTC
GTCGGAAGAATCAACAGGAAGGTTGGAATCGTACTTTCAAGCTGCTATGCGTCGATTCCTCAAGGAACAGCAAATTGCAGCACTGGCCCCGGTCGCGGTC
ACGACAAGGAACGTTGGTGCGCAAGATGCGGGCATGGAGTCGGTTGGATCGCCCGATCATCACCCCGCTCTCTGGGACTACGATCCCGAAGATCTGGATG
CCCCACCTACTCGTGCCGCAGTGGCCACAGCAACGCCTGGATCAGCTGGATCCGCGCTCATCCAACGTGTGCGGATCTCAGCAATCTCGGATATGAAGGA
GTTC