Description :
From Genome Similarity Track
Location :
Scaffold_350:7894- 13429
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-fgenesh-gene-0.0Kinesin
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.12ATPase
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.13Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.19Erythrocyte binding protein

Sequence
5535 bases(100 bases per row)
ATGATGGCGACGACTCCGGCGACCAGGATGCCGCTGTGGACGCACACGACGATGAAGACATCGACGACACCGAGAGCGACGGATTGGCAGGCAGTCCCGT
GAAATCGGTAGAGCGCCTCGCTCCGACTCGAGCATCGCGGTCCGTCTCTGCCTCTAGCGAGGACATCAAGATTCTGCACAGAAGTCTTCGTCGTCATTCC
TGTAAGTCCATTGTGAGAGAAACAGAGTGAAGAATCGACTTGCTAACTGCGGTTGGTACTCTCGTTATCACTGTGTGAACACAGCAAACGACGGAACTAC
TAATCGCGAGAACGAGATCAACTTGGAGGCATTGCACGGCGTGGTGCGATGTATTGTCAAGCTCAATGTCGGCTGCAACCCACTAACACCCTTGTTGGAC
TCAGGTTCAAACGCTGTACGAGGAGCAAGAGAGTCTGCTAAACTCCCACATGAGCGCAATCCAGGTAATACTGCTATCTTTTTCCGTTTGTTGCTAGCTC
TAAAGATTTTGTGACAATCCACTTGATGACCACTGGACTCGCAGGAAGATGCAGAGTTACTCACCGAGGAAGGTGCGCTGCTCGCTGAAATCCAAGGCGA
CGGTGCAGTCGACTACGACATCGATCGCTACGTCGCGCGCCTCGACCAAGTACGGCTAGAATGGTGTGACGGTGGCTTGTATCGGGTGTTCACGTACGCG
ACTGTTTTTGCAGATTCTTCAGCAGAAGGCACACACCATCAGCTCGCTGCGGAAGCAGTTGCGCTCGTTCCGCCGCCGCTGCGAGCAAGAGGAAAAAGTG
TCCAAGAAGATCTCCAACGTCCCCACCTATTAGATGCTGAGTAGCAACGATATCCATGGTGGCGCTGTCCACAGTTGCCGACCAGCAAGTAGGAAGGAAG
CCTTTGGCTCGAGCGCTTTACGAATATCGGATGCGTCGATCTTGAAGTTGCCTTTTATCGTTACTTCATGGCGTTACTTTAGCAGCTCATCCCTTCGAAT
AGTGCGCCATCACCGTGCATCCTTGTCACTTGGGTTTCTGGAAGCTGGGAAACTCGCTCAGCAATGCTTCGTCGTCGCCTGCGATCGCTGGCGCCGCGGC
TCGCCGCTCACTATGCGGCTAGTGGCGCTCGCCAACTACGTGCGAGCCAAGTTTACGCTGCTTTATGCGAGCGAATTGCTGACTCCGCTGTGGTACGAGC
CGTGAACACTAAGCGCATCTGACAATCGTCTCTCACACATGACGGTTGCTTGGATGATGAAGGGGTCTAGGCCTCTCGCGCATGGTCTTGAAGGGATGGC
AGCAGCAGTCAGTCAATCAGCGAGTGGGTCAGCATCATCTGTCCGCTTGCTGGCAGCGTGTGGAGTGGCTGCGGCCGGGATGGTGGCTTGGGGAGCGGCA
AGATCGGAAGAAGTCCCCAATCCGGCGGACAAGGTAGGCTGTCTTCTGCATGCAACACTGCAATACTGCTGCTGGTCGTAGTAACGGTTTTGTTGTGCAT
CTGCAGCGCTACCAGTACGCCGAGGTGGTCGAGACGATCCGCGCGCAGGTGTCGGAGTTCCGTTCGACGCTCAAGAGCCCAGAGATGCGCATCCCAAAGG
GCTTCCCGATCAAGAAGATCGCCATCTCGCGCATCCACGCACCGAACGGGGTGTCGACGATCCGTATCGAGTTCGCCTGTCCGTCATTCGTGGACCAGGA
GGCAGTCCTCGGTCGCTTCCTGCTCCACTTGCACAGTCGGTTGACGCCGGCGACGCGTCAGTCGGTCGAGGTCATGCCTGTGCCGCAGGAAACCGACCAG
ACCGGCAAGAAGTCCGCATTCGAGTCCTACGAGCAGCCGGCTGTGCAGTTCCTGTACTCGGACGGCAACGGCTCGTTCCAGTTTGTGCGCGACTCGTCGT
CGCTGGCTCCCAAGAGCAGCGGCAAGTTCATCTTCTACAAGGACGAGTTCCTTACCGAGAACGAGATCGACGCGATCGTTGGCGCGTACAAGGAGATTTA
CGCGTACCCGAACGTGAATGCGTTCTTCCGTCAAGAGATGGAGCAGTCCCGCCGCAAGAACATCTCGATCGCGCGAGGCGGCAACCAAGCCAGCACCAGC
AGCAACGGACCAAGCGATGCCAAGGTGCGAATGCACTTGGAATGTATACCAACGGAATCGGTGAACTAAACGACTGGTGTGTACAGGATGAGGCGATTCA
ACAGCTTCAGTCCCTCGGAATCCAGGTGTTCGAGCCTTCTTCGGCTGACGACAGTCTCAACTGGGACAGCTTGGTGAGAATGGATCGGATGCTGCACGCA
GTCGTCGCTTGTCGAGTTGTGTGTTGATCGACGACTCCTGTTGTGCAATAGGCTGGATACGACAGCGTCAAGCTGGAGATCGAAGACACGGTCGTGTTGG
CGCTGCAGAACCCCGAGCTGTATGAGCGTATCGCACAGAAGACGCGGTGTCGCTACGAGAGCAACCGGCCGCGCGCTGTGCTGTTCGAAGGCCCTCCAGG
CACAGGCAAGACCTTGAGCGCGCGTATCATTGCCCAGCAGGCAGGTATCCCGATGATCCACATCCCGATCGAGAGCGTCGTGTCCAAGTGGTACGGCGAC
AGCGAGAAGAAGATGTCGTCCATCTTCGACGCATGCGAGAAGCTGGACGGCGCCATCATTTTCATCGATGAGGTGCGTTGCAATCTGCACACAATCAAAT
GACGGCACATGCTAACATATCGCGCTGCTCGTAGATTGATGCGCTGGCGGGCGATCGCTCCGGCGGTATGATGCACGAGGCATCTCGTCGCATTCTGTCG
GTGCTGCTGCAGAAGGTGGAGGGGTTCGCGTCCGCAAAGAAAACAACGGTGGTCTGCGCCACGAATCGGTACGCTTGCCCGCTTTCGCCTCTCTCAATCC
TGTCGCGATTTACTGATCAGTGTATTGAACGATGCAGCAAGCAAGATCTGGACGCTGCTCTCATCAGCCGATTCGACCTGTGCATCCGCTACGAGCTGCC
AGATGAATCGACTCGCCACGCAGTGTTTGCTCGGTGCGTAGATAGCTCACAGTGGTGGTCTTTAGTAGTGTGTTGACTGGATTATATCGTTGGGTGCTCT
ACAGATACGCCAAGCAACTGACGTCGGAAGAGCTCGCCGAGTTGGCGGTCGTATCACCGCAGCTGTCGTGCCGAGACATCAAGGAGATCTGCGAGTACGC
TGAGCGCAAATGGGCCTCCAAGGTGCTCAAGAAGGAGCAAACGGCCGAGCTGCCGACGCTGCAGGCATATATGGACGCGATCAAGATGCACGTGGCTGGG
ATCTCCAGGCGCGGCCCGCAAACGGACGTGTTCGAGGCGTGAAGAGATCTGATGAGGCTGTGAAGCATGATCAAGCGAGGTTGACATGCTGTTGACGAGG
GATGTGGTGTCAGTATAACTGGGATAGTGGTAAATAGGGTTACAATATCGGTTATAATTGATCTGCATTGCCACGCAAGCCGGCAAAAATGCGGACGGCG
ATGGTCGCGTGGCTCGCGCTGGCGCTCACGGCCGCCGCCACCGGGTTGTGCGCCGCGTCACCTCGCGTGAACATCCCCATCGTCGCTCGTCCTCGCGACG
AGCCCGAGTTCCGCGGGCCGTTCCCGATCCGCGAGCCCGAGTGGGTCGGCAGAGGTGCGTCCGCAACTCCTGCTTCAATCCGGTGCTTGGCGACTCACAT
CCGTCGACAGGGCCGTTCGCCAAGCGGCTGTGGGCTCAGGACTGCGTCAAAGGAACGAAGGCGACGTTCAGCGAGGACGAGTGCGGGATTTGCTGCCTCT
AACGCTCTGTACTGCTCTGAACCTGACGATATTGTTTGTGATGCAAGATATCTGCTGGACGTGTGTCAACTGCGCAACGTGACGGCCACCAAGCAGATCC
CGGCGCCAGTGGCGAATGCAGGGGGCTCTGCGGTATCTGGTGGGTCTGGCGAGGCCGCCACGCCAGCACCCGAGCCGGAGGTGCCTCGGCTGCTCGGGTA
TGAAGTCATATAGGCTGTCACGATTGTGGCAGCAGTGCCGTTGTTTTACCGTGCTTTGCTTGTTGCAGCATCTTTCGCGGGTGGAAGGTGGACCCGATCA
CACTTGAGTACAAGTACATGGTGTTCGATGACGGCGACGAGTGCAGCGGCGGCCAGCGGTTCTCGTTCGTGCTGGAGCTGATGGCGGCCAAGAACGAGCG
CACCAAGCCGCGGGTCGTGGCGCTCAAGCAGTCGCAGGAGTGCCAGTTCTACGGCAAGCTGCTCGCGTACGTGCCGGACGAGGACCGCGTCGCGGCCAAC
GGCATCCACACACACGGCGTCATGGACATCAGCGACGCGCAGGAGTCGCTGCCGACCGTGTGCGGCAAGATGAAGTGCCAGTACGGTGAGCTGTCGTCCC
AAGTGCGCCACGTCAACAGCCAGGTTGATTCAGTTGCTTGCCTCATTGAGAGGAGACTTGTCCTTGTCTTGCCAGCACACTCATTATTTGATGCTTCGAC
AGTTGAGGAAGGTGCAGTCTCTTGTCAAGGACGCCACGGGCGAGAACTCGTCGCTGTTCGCCAACTTCACGATGGAGTCGGCGCAGAACACGCTCGACCT
CACGTCCTTCGTGCTCGAGAAGGCGCTCGAGCTGCTGCAGTCGCTCGAGGACATGTCCAAGCGGCCGGACTTCAATCACGAGGCCGAGCCGCAGGTCGAG
GTCGCCGTGAACGAGGACGCCACGACGGACGTCCTCGACGGATCCGAGGCAGAAGAAGAAGCTGAGCACGATGCGACGGACGAAGCCCTCGAGAGTTGAG
GAGCGATCCATTCAAATTGTTCAGCGGATCGACAGCCCGCCCACGCTGCTAATAACTTGTTTGTCTCCCATAATCTACAGCCCACCCAACCCGATACATA
CGTCTTCCTCCCCATCCAGCGCGCTACGTCTTCCGCAGCCAGTTCGTGAGCGTGTACTCGCGCCGGTCGCCCGACGAGCGAGCGTCGCCGAGCCCGGGCG
ACGCCAGCATCGGCGCGTACTCCTCCTCGTTCAGCAGGCTGCGCATGCTCGGGACCGCCTTCCTCGCCGCGGCATGCAGCAGCGACGCGCCAGCCGACAC
AGCCGTGGGTGGAGCCATCATGCCACCACCACCACCACCACCGCCGCGAGCTGGCATCGCCGCCGAGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGGTTGCTTGGGCAGGAAGAAGTTGGTGAGCTTGCCCGTCTCGTCGTACCCGCGGCGACACACGAGCGGCGCCGACGTCGCCTCCGGCAG
GCTGCTCGCGGGCGTCAGCTGGAACGCGCCGTAGTGGCTCTGGTTGTAGCTGCTGCGTCCGAGCGTCGCCCGTGGTGCCGACACGGGCCGCACCGACACA
TCCGAGTACGCATTGACTCGGTAGGATGCGGCCTCGGCTCGCTGCGAGTACGCCGCCGGTGGCGCTGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CGAGCCGGCGGTCGCGAACGGCACTGGAGGAGCAG