Description :
From Genome Similarity Track
Location :
Scaffold_637:7894- 9289
Sequence
1395 bases(100 bases per row)
TCATTCGATTTCTTTTTGCTGTACGAATGGCTGTAAGTTTGCTGAAGTATTTTTCGCAGGTGGCAGTATTAACTGCGATCAAAAGAATTGTCAAAGCTAG
CTTCGGTAGTTTAGATGCAGCGTTCAGCTCCTGTGCGAAATTCCAGTACTCCGAGACATCACCGGTGTACTGAACATAGTTGTTGTTCACAAATATACCA
CGATACCAGAGAAGCAAGTCCCGACCCAGATTCTCAACGTCATCTCTTTTAAAGTATCGACGATAATAGTAGATTCCATAGCCACACAACCGCTCAAAAA
ACTTCAGGTCAGGGACATTCTTGTTTATCGCCCGCGGGCAAGACACATGTCGTGGATGTAGGAGCAGAGCCAACAACATTAAAGGTTGCTCGCATCGTGC
CCATCGGTTTTCAAGTAGATCCACCAGTTCCAAGCTTTCCAAATTGCTAAGGAAACCACGGTAGATTTCTCGGTAGGACTCAACAACGTCGGCCAACGTG
TTCTCGTCCCGCTGGAGCTTGTAAGAAGCATTTGAAAGCGGACGAATGACCTGCTCAGCCTCTTCAAGAGACTTCCAAAATGTCGCGTCACTAAAGATCT
TTAGAGACTCCGGAGACGTGCCATCGGTGGAGTATTTAACTGCGAATCGCTCTAGGACGTTACTGACTCGTAGGAGAGAAGCGAAACAGCCCTACATGCT
GTTCCACCGAGTTTCGCACAGATTGATAAATCCCAGAGGCTTGCCGTAGGCTGTAGTAATAATCtcttgagctcgaagaagccattTGGAAGACGATGCG
TTCAAAGTCGTCGTAGCTATTGATGCTTGTGCCGTCAGCTTTCGATACGCTTTTTTATGAATGCCCTTAATCAAATTGTTAATATCATGCGCAAAACAGT
GAAATAGAAGGTCGACGAAGAGCTAGAATACGTCGCGCTCGACCACACTGCCCCGCATCATCCGTCACAACGTCTCCAATGTCCCAACCTTTCCGTTCCA
TGTCTTCAATCACTTTATCCATTTGTTTCGCGATGGCAAGACCATCATACCGTGAGCCAGTAGGGAATAAACCAAAGGTAGCGACAACACCGTAGATACT
AAGCTGGCATCCAAGAAGGTGTGACTTCGCAACATTTTGCCACACGTCAGACAAGAAATTAACACGTCCACCGCCAAATCGCGCTTTAGTTCGAAGTGCA
TCCAGTTGATtatcttccagcagcgagctATGTTTCTCCAATATACGACCGCCAAGCGCGTTTCTTTTAGGCATAGCTTTCGCGCATGCCTTATTTAGGA
GCGTGAAGAGGCGACGTGTAGATTTGTTTTCAATAAATCTGTCCGGTAGGAAATTGCCTGCTTGGGATTGAACCAAAAGACGCTCGAACTCGTTT