Description :
From Genome Similarity Track
Location :
Scaffold_615:7893- 11580
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap-piw_contig_615-abinit-gene-0.24Ser/thr kinase
Pytiw_DAOMBR242034maker-piw_contig_615-fgenesh-gene-0.3Kinesin K39

Sequence
3687 bases(100 bases per row)
AAGGTCATCAAGAACGCGAGCCCACTGAAACAATTCGCGCTGCCGATCCTGTGCGACCTGGCGCACGCGTCGCCCACCGCGCGCGCGCACCTGTGGGCCT
GCGACGGCGTTTCGCTCTTCCTCGAGATGCTGGCCGACAAGTACTGGCAGCTGGACGCGATCAAGTCGCTGAGTATCTGGCTCATCCACGACACGGTCAA
GATGGAGAACGTGCTGCTGATCCCACGGAACCTCGTGCAGCTCATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCACACCTCGCCCACGCAGTTCCTCGTCGAGTTCAACCTGCACCCGACCATCTATGCGCTGGCCCAGGACGAGAACA
ACATGATCCTCGTCAAGGAGATCGCGTCCCAGCTGCTGCAGGCCATCCTCGTCGCGGCCGCCGTTTTTTAGAGCACAGGAAGCCTAGCCCAAGCCTCCCT
ATTTATTACCAATTCCAAGACACCCGCCCAACCCCAGATACCCACCTCTTTGATTACTAACTGACTAACATCTTCACTTGCGGCTTTGGGGGTTCTGGTG
TTGCTGGTGTTGCTGTAGTGCGGCTGCCAAGAGCTCCTTCTTGTACTTCTCCATGCTCCGGTGTGTCGACGCACTGAAGGACGGTGACGCGCTCCCGCTA
CCTGTTGACGACGCTGCTGTTGCCCTAGCGCCCACTACTCCAGCACCCGGTGGCTGTTGGCGAGCGAATGTCTTGGCCACTTCGTGCTGCACCTGATCCT
TCACGACGCTCTTGATCATGGCCTTGGTGGGCGGCATCTCGCTGTTGCACGAGATGCACTTGGCGCCAATGAGCGGCGCGTTCCCTGGCGCGCCCCCACC
AGAAGCCCCACCGCCGCCTTCAGCCAACCGATTGCGCTGATCGACCAACAACGCGTTGAAGTACGTCTTGTCGAGCTTATTCCGCAGCAGGCGATGGATG
TCAACGAGGTCGTCCTCGCCCAGCGAGCTCTTGGCGACGCTCTGCAACTGGCGCTCGAGCACCTCCTGCGTCCAGAGGAGCTCGTCCTTGTCGAGCTTCT
TGTTGACGCGCGCCACGAGCTGCGTGAGCTCGCGCTCGAGCATCTCGTCGCGCTGCTGGGCCTCCAGGTGGCTCTGCTCGAGCTGCTGCGAGAGGTTGTC
GCGCACGCTGTCGGACGAGTTGAGCATCTCCTGGATCGACTTCTTCACGTCCTCGTCCTTGGCGAACGAGAACGAGAGCTCGAGGAACGAGTCGAGTCGC
GAGTTCATGAGCTTAACCGTCGCGCCCACAGTGTTGAGCTGCGTGAGCGCAAAGTCGTGCGCGCGAACATTGTGGCGGAGTGTATCCTGATCAGCCACGA
CCGTCTGGAGCCGCTGGTGCGGATCGAGCAGTTCATTATGCGTGAAGAGGAGGATAAGCACCGCTCGGAGCTGCACGACGAGGTCCCGGATCTGATTCGA
CACGCCCGACGTCCCAGGATCATCATCGTCTTCAGCACTGGTTGGCTCATTGATTGACGCCAAAAGCGCCTCGAGGGCCTTGAGCTGTGTCGACGTCACG
AACACAAGGCGATCCGTGAAGCTCGAGCTGCCGTCGCTCTCACTGGCGGAGCTGAAGGCCGAGACCGCACTGGATTTGACCTTTGCAGCCTGCTCCTTGA
GCTTCTCCAGCTCGTCCTGGAAGGAGATGGCGCGTTCCAGCAGTGCGCCCAGCACGGGCGAAATCGAGTCTCCCGTTTGCAGCGCCTGGCGGTCCATCTG
AAAGCACGTGAGGATGCTCTGAAGCATCTCAAGCCCCACGTCAAAGAGCGATCGCTTCTTCTTACCACCACCAGCTGTTCCAAGAGACTGCTGGGGTTTA
GCACTGCGCACCATCTCGAGCGACACGAGATGCGCCCTTGAAAGGCCCATGAGGTCCCGATACAGTTGCGAAGCCACCGCGTTTGTGCGTCTCACAAGTC
CCATCTCAGCAGCCGCCTGCGCCGTCTGAACGCGATCCATGGCCCTCGTGAGCTCCTTGGCGATCTCCTTGGCCTTGTGGTCCACCTCGTGACGGAATTC
GTGCAGCATGGTCTCGAACTTTGAGCTCAGCGCGGGCAGCTCAAGACCATTGAGCTTCTGGACCGTCAGCTCAACTTCGTGGAACGCAGTGATGTGGTCA
CTAAGATGAGTCGCAAGCTCCTGCTGCTTGATCGTGAGCACGCTCACGGCAGCACTGGAGACTGCCTGACCGCTCTCTCGCCTACTGGAGGTGCGCACAC
GTCGCAGATCCAACTCGATGAGGTCGAGTTTCTCCTCGACACCGATGAGCATTTGGCCCTGGAGTTGCTTGTCCTCAGTCAGCTGAGCGACTTGGGTGTC
CACGTGGGCCTGGTGGTTCGCGAGGCTCTGGCCCATGGCCACCACGCTCTGCGAGTTCTGTTGGATGTTGACCTCGAGGACGTCGACCATCTCCTCCAGG
TCGGCCGTGGTCTCTTCGAGTCGCCGCACGCGGGAGCCCACGGACTGGTTCTGCTTGCGGAAGATGCGGTCGGGACTCGTGCCGTTGAGGATCTGCAGCC
GCTTGAACTGCACGAAGCGCGTGAACATGCGGCGCCAGAGGACCTTGAGCTCGTCCCTGGCCATGGGCGTGCGCATCTCCGTGGCGGTATTGCTGCGCGA
CGAGTCCAAGCTCGAGTCCTTGCGAGCGTTGCTGTGCTGGCGCTTAAGTACTCTAGTGACGCGTCGCGAGCGGATCATGGCCGTCGAGGCGTTGAACGTC
GGGTAGAGCATCGCCAGGTTGGGCGTCGTTGGCATGTGCTGCATCGTTGCCGCAGGCGCGTGGACCACTACGGGGCTCTCGCGGGGCGGGAGTCGGGTGC
GGGATGTCGTTGGGAGGATCTCAACCACGCGGTCCGTCTCTTCCTCCTCGATGGCCTCGTTCTCAGCCTCGGGTGCTTGCTCTGGGGTCTCAGATTCTGC
TAGTTGTACCTCAGCTGGCTCACTTGCTGCCTGGATTATCTCGTCAGCTGGGTCTTCTTCAAGCACCGTCAAGCGACCTGAGTCTACTAGAGTGGTGATG
GCCGTCTCGACGAGCTCTTCAGGCGACTCGGATACAGTGATCTCCTCAGTCTCTTGGATCGTAGCTTCAGGGACCAAGCCCACCGTCGCTTCCTGCGCGA
CCGCGTCGTCTGAGACCTCGGGAATGGAGATCGACATCCTGGAGCTCACCACTAGCTCTGTCTCATCAGGAGTCACGTCAGAGCGGCTAACCGATAGCGC
CACCAGTCTCTCGCGTCGGGATGTAACTGCCGGTCGGCTCTCAAATGCCCCGTCGATCTTTGGAGCCACGCCGACAGTTTTGCTCCG