Description :
From Genome Similarity Track
Location :
Scaffold_682:7890- 13729
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_682-snap-gene-0.1Sporangia induced dynein heavy chain
Pytar_ATCC12531maker-par_contig_682-snap-gene-0.6Nudix (Nucleoside diphosphate linked moiety X)-type motif 22

Sequence
5839 bases(100 bases per row)
TTGGAGTTTTACATGCGCGACGAGCTGCTGGACGAAATGGAGATGTTCCCGTTCGTGGGTGACGACAAGGGGCCGTCGTTCATGACGATCCCGCCGTCGT
CGTACGACAAGTACCTTGAGCACATCGACACGGAGCTCAAGACGGACTCGCCGCTGGCGTTTGGGCTCCACCCGAACGCTGAGATTGATTTCCGCACTTC
GCAGAGCGAGAATCTGTTTCGCACACTAATGGAGTTGCAGCCGCGCGACGCGAGCGCCGGTGACGCCGGCATGAGTCCCATGGACATCGCTAAGGCCGCG
CTTGAGATGGTCATGAGCCGCGTAGGCGAGAAGAAGTTTGAGTGTGACGACATTGCACGCAGCCTCGAAGAGGTCGGGCCGTACCAGAACGTGTTCCTGC
AAGAGTGCGAGGCCATTAACGGACTGCTGGTCGAGATGGTGCGGTCGCTGAACGAGCTGCAGCTCGGCTTTGCGGGCGAGCTGACCATGTCGGACGCCAT
GGAGGCCGTGCAAGAGTCGCTGTTTCTCGACCGCGTGCCCAAGTCGTGGGAAAAGCTCGCGTTCCCGTCGCTGCGACCACTGGGTGCGTGGCTCACGAAC
CTTGAAGCGCGGCTCCAGCAGCTCGAAGAGTGGACGCAGAATCCCGTGGATATCCCCAAGGTCACGTGGCTCAGCGGCATGGTCAATCCGCAGTCGTTCT
TGACGGCGATCATGCAGGTCACGGCCCAGAAAAACCAGTGGGAGCTGGACAAGCTCGTGGTCCAGACCGACGTGCTCAAGCGGCGTAACGGTGAGATCGA
CGCGCCATCGCGCGACGGCGCCTACGTGCACGGGCTCTACCTCATGGGCGCGCGCTGGGATGCGACCAACAACACGGTCGACAAGTCGCAGCCCAAGGAA
ATGTTCTGTTCCATGCCTGTGATCAACTGCAAGGCCGTGGCCGCCGACAAGCTCGACACGAAAGGGTCCTATTTGTGTCCGTGTTACAAGACCGAGTCGA
GAGGCCCGACGTACGTCTTTTCGGCGCAGCTCAAGACGAAGTCGCCGCCGGCGCGCTGGATCCTCGCGGGCGTCGCGCTCATCATGGACGTCGTGACCTA
AGGAGGTGTGTATTTCTCTTTCTATCTACGCTGTGGTCCGGAACGCGCAGAACTGCTGCCAGAGCGAGAGGCTGCCCTGCGCCGCCGGCGTGAGCTGGTA
TCTACATATACGATTACATTTCCCTATGAGCACACATCTACTCAGAGATGTAGAGGGCAAAAGAACGACGTACTTGTTGAGTGTAGATTGGTCGACCCAG
CAAAGCCGCGTCGACTCGAACTTGTCCTGCGGGCCAAGACGATAGAGTGCGTCCACTTCTTCGGACGAGAGCGGGGTCGCCATGTGGAACACTACGAAGA
ACACACCACAGGTGAGCCACGCCAACGGGGCCGCTTCTCATACCCAACGCACCAAAGCTCGGCGTCTCGGCCTCAGACTGGAACACGACACCCAGCAGCA
GCGGATCCGACAGCTGCGTCGGCGACAAGTTGATCTCCTCGTGGACTTCGTCCACGATCGAGCCAAAGAGCCGTTCGACTGCGAGCGCTTCCACGGCGGT
GGCGCGCTCGCTCCCCTCTTCCAACGTCTCGAGATCCTCCATCGTGAACGGTAAATCCTGATACAAACTCCAAGTCAAATGCGAGAAAGTACAACCCCCT
CAAACTCCACATACCGAAGGTTCGGGGTGGCCGCCGGGGGTGTCAAACAGCTGCTGGTAGACACCGACGCTGCGACTCCGCTCGATGAGCGCGACACGCT
GGTCACGGGTCTCTACGACGCCAGAGACGCCGACCTTGCGCGAGAGAAACGCCGTCGCGTCGCCAACATGCAGCCGCTCGCCGTCGCGCCTCAGCTGCGT
CACGAGCGTCGAGCAGCACGTGCCCAAGTACGCCTTGTAGTCCGTCAGACCGCACTGCAGACTGAGTCTGCTGTTGTCTGCATCGAGTCGCCAGTCGTGG
AGACGGAACTTGGTGCCGTTAAAGAGCCGCGGCGCGCGCTGCTTGTGCGCGGCCCAGAGCTGCTCGATCGAGGCCTCAACGAGCGGGTCCGGATGCGGCG
TCGCGCGGTTGAAGCGCCGCGACAAGCGGATCTGCACAGAGGATCTGGGGAGCGGACCAATGGCAAGAGACGGTGCAGACGCCGTGGTCGTGGGCGCCAC
GAAGCTCGCGAGGGAGAACGCCATGAGCCGCGCGAGCCCAAGCGGCCGGATCATTCCCTTCGCGGTTGTTGGGAGAACCGGATACTGACATCCGCGTTTG
AGTGACATCCCCCTTCAAATACGACATCGTATTTTGTGTGTGCTGTCCGTCACATACTATTTTGTGTCCACTTGACACAAATACGATGAGACGCAGGTTC
TGGGAACGGAAACTCAGCGGAGCCCCTCTGTGCTTCTCGCCATTGATTGTTCGGCTCTTGCGATCGCGTAAAAGCCGTGGACATCGCACGGCATGATTCC
CGTGGCCCCTTTTTGGTGAGGGAGAAGATACACAATGTGGTCCACAATACAGTGCACTGGACAGACATGTTCAGGTATCAGATCCGATGGCGAATTTCGA
TTCCGGATTATTATTGAAGCCACATTTTGCCGCACGGAGTCCTGAAGTTTGCCAGCGGTTTGTGCTGGCGCAGAGAGCTCTNNNNNNNNNNACAGGTTGC
GCGGACGAGGCCGTGGCAGCAATGGCGGAGGTGAGAGCAACGGCGATCTTCATGGTCTTGATAGAGGGAGTGGGGGGAGGGAGGCTTGTGGATTGGAAGG
CAAGTTTCCGAATGAGAGAAGATTGCTCCAGCGCGCTCGTGGAGTTTGGTGATGGCGATCCCGTGGTGGGAAGGCGGGAGCTCTCTGATGAAGATACTGT
AGGAGTCAAGAGAAANNNNNNNNNNTATACAGTACTGGACAGACATGCTCAGGTATCAGACCCGATGGCGAATTTCGATTCCGNNNNNNNNNNGTCCGTG
CGCGCAAGTTCATGGAGTCCACGAGCAACAGCTACGCCGAGATGGACGTGATGCCGATCCTGGATGCGGCGAACGCACTGGACGGGGCTACCAATGGTCT
AAGTGCTGGGGTCGAAGAGAAGGCGACGTTTNNNNNNNNNNGAGGCCATCCGCCAGGCCAAGAGTTACATTTTCAGTGAGGACCAGTACTTTACCAGGTG
CCCGAGCTGCTCGCAGCATGACGTCCGACTCGGAGATGGTTGCGAGCGTCGTGAACAGGGGCCTCTCAGTCTCGACCGACGGGTTACTGGTCACCAAGAC
CGCCAAGGACNNNNNNNNNNTCACGCCCAAGGCGACCCGGACGACTCGTGCTGAACGGGATGCTCGTGGAGATAGTATAGCAGCGAGTGATGTGACTCAA
AATGAACGTCGTTGGTGTAGCGAACATGTTATTCTGCAACTCGCTCGCCCCGCATGTGACCTGCGGATCCATGAGTGAAGGGCCGTCGTGACCTGAATCA
ACCACGAGCAGTGGCGACTTGGTGCGTGGTGTCACAACAAGCAGGTGGATCGTTCTAGGTAAAGCTCTACCCTTCGCACTACAGTACGNNNNNNNNNNTC
GGACCCTGATGACTCGTGCTAAAGGGGATGCTCGTGAAAATAGTACAGCAGCAAGTGATGCGACTCAAAATGAACGTCCGTTGGTGTTGCGAACATGTTA
TTCTGCATCTCGCACGCCCCGCATGTGACCTTCGGATCCATGAGTGACGGACCGTCGTGACCTGAATCAACCANNNNNNNNNNAAGGGCAAGGACCATAC
TGGAATCCCAATTACACTCGATCTTGGTCACTAAATTTGACTCGATCTGATCGAGTAACACGATCCCATCACGTGGCATATCCTCCGGCGCACCGGCCGC
AAGGCCGCATGCGCGCTTTCCAGCGCGTCACCCCAGCGCTGCCGTGACGCCCAGTCCAGTCATCCAGCGCACCAGCCGCAAGGCATCATGCGCGCTATCC
AGCGCGTAGCGGCCGCATGGCCACCACCGTCGCTTCCCAGCCGTGAACCCTACGCACTGTCAGGTCGTCTGTGTCCCCGTGATGCCGCCGACTTTCAGTG
CACCCCNNNNNNNNNNGCGGGCAAGAACCAAACTGGAATCCCAATTACACTTGATCTTGGTCACTAAAATCGACTCGATCTGATCGAGTAACANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAAACCCGACGTCTGTGGCTTGGTCTCCTCCGCGTCCAGTCCGAGGT
TCCAAGGAGCGATTTCGAGTTTCGAGTCGCCGTATCGTTCAAGCTTCAGCCACCAGCCAAGCAAGAAGTCCGAAGGAGTTAAGCAGTCCCAGTACGAGAC
CGGAGGCCAAGTCGTGGAATAGGGTGATGGTGCAACCATGGATCAAGCTCCCAGTTGTCAAGCCTTGCATCCTACGGCACATTTCGGATACGAGGTCGTC
CCTGAGTATTTCATGAACGATCTCCGCCCATAGATGGCGGCCTTTCTTGGCCGCCATGTTGTTTCTTCTTTTGCGTTCTAGGAATTTCGATTCCCCTCTG
AAGCTATCGGGTACATTTAATGCGCACAATAGACTTCACTTGCATCATCATCATCATCATCACGTGGCATACGTACTGTAGTGATCGTGGACCATGATTC
GATTGCAGTAAGGTGGCTTTGACGTGTACAGTGCCCAACTGTAGTCTGGGGGAAAATGCGGCAACTTCTGCTAGTTATAATAGTAGTAGTACTACCGCGC
ATTCCGAAGAACCGTTCATCGCTGGTCTCCATCGCTATCAGTATATGCACATTGCTACTTCTTCTGGCAACCGATACTAGCACATGCTTGAGGTGAAAAG
AAGACATTTACTAGTATTCATTCTGTATACGCGACAGTAGCTAAAGGGACTCGAGTACGAGATGAAGAAAACGAATGCAACAGCAGGCTCGGCGCCTCAC
TCCACTCCCAAGTGATCAAACAGGATCTTCAAACCCACTTGACCTGCGGGACGTNNNNNNNNNNACTCTTGTGTTTGATAGATTACAATGCCGATCGAGT
CTCTGCATAGGCAACTGAATTGTACCGTTATGATGGCGATGAGATGCCATGTACTGTATGGGCTCGTACGAGTCCGACTCCTTTTGTCGTCGTACAGTAT
CTCCNNNNNNNNNNTATGCATATTGCTACTTCTTCTGACAACCGATACTAGGCACATACTTGAGGTGAAAAGAAGACATTTACTAGTATTCATTCTGTAT
ACGCGACAGTAGCTAAAGGGACTCGAGTACGAGATCGAACAGGATCTTTACACCCACTTGACCTGCGGGACGTACTGGTCAATGAACGCACGACCAGCAG
ACACGCGAGCGTACACGCCAGGGTACCCCAACTGACCGCAGCCGCTGCCCCAGCTCACAATGCCTACGAGCGTTGTCGTACCGTTGCTGTTGACAACGAG
CGGACCGCCCGAGTCGCCCNNNNNNNNNNCGACTGATAGGTACAGAAGGTGGAGTCCATGGAAGATCTGTGGACTCGTGTGACCTGTAGAGGCGGACAGC
GGGAAGCCTCAGCCGGAAAGATCTTCAAACCAGATTGTTCTCGCTCTGATGAGCGATCAAGTTGTACGCTTTTGTGTTTGATACATCACAACTCCAATCC
ACTCCCTGTACAGTATAGGCATTGCCTATTAGGCAACTG