Description :
From Genome Similarity Track
Location :
Scaffold_227:789- 5419
Transcript NameFunction/comments
Phyag_g3698conserved hypothetical protein
Phyag_g3699hypothetical protein PHYSODRAFT_473346

Sequence
4630 bases(100 bases per row)
GAGACTTGGTTACGTGGCACACGTCTCCAAATTGGTTCTTGATCCGGACGTCCTCGTGGGGCAAGCAGGTTAATGCCTCCTCGATCAGAAGCCGTACTAG
CCGCGTGGCTCGTTGCTGGAAAAGTACTGTACTGATACTTTCGTCCCGCAGCGCCGCGATCAAGTTCCTACAGGGATACGAATACGCCGAAGCCTCGTGA
ACAAGGAACGACCGAGTTGCCACCGGACTACTCGCTGGTTCTTGCACGGGGGACTGTTGCTCCGCTTCATTACGGAAATGATTGTGGTGTCCCAATTGAT
GATGACGATCACCTTGCAGCGCAGTCGATGACTCTTGACTTGATCCGTCTTCGCGCGTTGGCCGGTACAGGGTAGATCCCTCCATGTTTGAGCCCACCGA
ATCATCGCGCGgactctcctcctccgtaTTAATCGATATCGAGGACACGTCGGGGTAAACCGTTATTGATTCaggcacagcagcactcgctTCATCTATC
GCCACGGACTGCGGTGTCAGGCGTGGGCTTGACCTCTTGACACGTGCCTTCTTTGGGTGTTTCGAATCGGGATTGCGATTGCCCCGGGTAAGCACCTCCC
ACCGGTTCTTGTAGAGATTGCAAATAGCAGCGCGACTGACACTAAACTCCCTGGCGAGTGTCACTTGCTTCTCCCCTGCATCGATCCGCGTGATGATCTC
TCGGCGGTCGCCCTCGCTCAGGTACCTTGATGTGCGCTCGCGACGGGGGGCGGCGGCCGGCTGCGGTGACGCGAAATAACTTGTGGTCTCGCCGTCTGGT
TTGTCGCCATCTTGAGAGGATGCTGTAGACGAAAATGAGAATCCCTTGGAGAGAACGAGGTGGTCCTGAGACTGGTAAATACTGTTGAGACGCGAGAGCG
TCGCGGCGTTTGACTGTTTGTCCTCGATGTCTAACGCTTGCTTCCTCTTGAGCAACTCGCTGTCGAGGTCGAGTGGTGTCGGAGACCCCGGACGTACTGC
GGAGAACGAACCTTCAATGCTGTTGCGGCGCTTCTTGACGCCCACGGTGCCGGTGGTAGCCATACTGGAGCTACGCGTgtcagaagaagacgatggtaGG
TAGGAGGAAAGCTGAGGTAGTCCGATCGGAGACGGCTCCATGACTACCAACTGAGACCGACGGTGCGTAAGTTTTGTGTTGGCGCTGAAAACTTGAGTGA
GAGAGTGCTGGACCTCTCGTTTCGATGTGTGGAGTCACGTTCCGTTTTTGGTAAGGTGCTTCTCTGCTCGGTAAGGGAAATGTACGTGTCACTCTCAAAT
CGAGTTGACTGGAAGGCGGCAGGGGCCATGAGAAGGGACTATGTGTGTTGTGTGTGCAAGGCGTCTCATCAGGCCCACCGTGGTTGGATTAACGAGAGCA
TCAACGTAACCATTCAGGTGTGAGTTTACCTTGCCGGTGCACTCCGCTCTCTCCTTACCAAGGTCCCTTCAACCAGTTCGCACGCTGTAAACAATGATGC
GTGCGTGCCGCCACAGCGTGATGGAGGAAACTCCAGTGGAGGCCCACAGCTGGTTGCAGTTTTCGTCCAAGGCGTCCGTCATGGACAGATCTTTCACAAC
TgcctcgtcgccgccgtcaaGCCAGGGGACTTAACGCGCTGCTTCCTAGCGAAATGGTGCAGCAATGCACGATGGTTTGGGTGTGGCTGGAGCTGTCCCA
ACAATACAAATGTATGAAAACTGGCTTTGATCTCCCGCGAAGCAGCCGAGGAGACAGAGACGATCACACCTTGAAGTTAACTCGATTGCGTCAAACTGAA
CATGACGGGGTCGATCAGCGCACACACAATCATAATCCGTGGGCCATTTTTCTCGCTGCACTGGATTTAAAGCCTTGAGTTCCCGCGTTGCAGTAGTTGC
TCATGAAGTTCATCAGCAAGAGGCATTATCAGTCACTCACTCAGTTGTCGACGACTCTCGGTGAAGCCAAGCTGGACAGTGCAAATCTGCAACTCCATTT
TGGAATTCCAACCATTGTTGGTCAATCATTAGGGTAATGCATCCGATCATTCCCACTGCAACTTACAGCGTGCGCTGTATACAAGTGCCACGTGCGTGGG
GTCAGGATATCGTCAATGAACCTTTTCCTTCCAGCGTCGCCTGGTGCTGTTTTGCAGGCGAAGCAGATCCGACGCCGAAAGGCTTCATGGTCAACTTGGT
TCGGGTGCAACCACAGTCTACCTAGTCGGTACTGTAACCGACCGCCAGGTTTATTGAGGAATTTGGTCTCGTCCATGGCTCGTTCATGAATGGACCATGG
ATCTGCCACAAggttgcagcttctgcgcaGATAAACACTGCTTATCGGCGACAGCCCCACTTTGGAAAATCTGCTTCAAAACGCAAGCTGGTTGTGAGTT
ATCGCTTGTTGTATTATTTTCTGGAGTTTAGATCGAAATTGGAACGCGAAGGATCCGTGCAAGCATCGTTGCCAAAGGTGCCGCGGAGCCCAGTTGAAGT
GTACTAGGTAGATTGTGATCAGGTTACCACAGCATAATCTACCTCGATCGATTACACCGCCATTGTTATCGCTTACATGTAGCCCGCTTCAACCTCCCTG
CAACCACGCCTCCTTTGATGCCGTCGACAAGAGCGGCTTCATACACACAGACTCGTTGAGAATTGATCACACCGTACACGTACAATGATTAGCAAGCCAA
AAATGCTGCCCTTACTGTAGtgctcctcttcatcctcgacTACAAAGTTTGTGTTCCTGTGGTACAGGTCCTGTACAACCTGTACTGCTACGTAGTAAGG
CTTGAGGGCTGCAATGATTTCAACGGAAGCGGGACATGTTCATACTACAGATCCGAACAACACTTTTATCATTGATACGCTTATAAATGCGTGGATTTAC
AGGCACCATTCGCCTTGACAGACACCATTGGCCTTCTTCGTGACCGCATTATTGTCTGAATACCAACCCCCTCATACCATTGCAGCGAAGTGGACGCGTT
GTCGCTGTAAGAGTTTCGCGGCTTCTTGATCGCCTCCGCGACGGCAGACTCTGGAAGCGACCAGCACAAAAGCTGCGGTTGCGGCAATCCCACCAAAGAT
AATACCAGCCGACGCAAATAGCAGCGATCCAGCCGACGTGGAGATGGATTTTGGGATGGAAGACGAATCCTTGGACTTCGACGCCTTGGTGGATGTCACA
CAGGTGTTGTAGTCTGCCACCGTAGACCACCAATACAGCGAGCACAACCACTGAGCTTGGCACATGGCATCCAGACACGTGGGCTGGAGACGTGACTGTG
CCTTCGAGTTGAAGTAGTACTGCTCTAGCAAGTCTGCGTCCGCTGCTGTACGCTCCACAAACCTGGTAATCTCCGATGTGCTCAATGAACCCACATCATA
CTCCGTGCTTGCTTTGAAGAGAGGGTTCCAATCGACATCCTGGGTTGTGGAAGAAATGTTGCCGCCGTAAACCGTGAAGTCGAGAAGATCGTACGTTGAG
GCGTTAAAGTCCCAGACCATGAACGCTGGGTTGTTGAAAAAGAGTGGAGAAATCGCCGCCGTCATGAACAGCGGCACCAGGTCGGAGCTGTCTGTGTAGT
CATCGTCCACAGTCACTCCGTTTCGCTGGAATTGATCCCCCAGTCCGCTGGGAAGTGGCAGTCGGAACTCAATACTGTGGATGTGGCCGAAGAATTGAGC
CTTGATGACATCCGTGTACAGGTTGACGATCTGCTTGTATGTCTTGACGTACGTCTCGTTCCACATAGGTGCCCCGCTATACGAATCGATAATCGGCGGA
ATGTGGCCTACAATGTAGGCCAACTTACCAGCATTGCGCAATTCGGACAGTGAGGCATTCAACCACTGGAACTGGCCGAATGGGTCGGGCAAAGTTGACG
TATCTGGTAGGTGTTTCGGCTGCAAAACATCAAATATCGCAATAAGTGTCAGTTGTGATGGTAACTGCAATCCTTTCTCGTAGGGAACGCACCGAATACG
GGAGCGTGTTTATAGTGATCACGATCAGGTTGTCATCCAGAGCGTACGCTAAATATCCGCGGTGGTTGAACCAGTCAAGGTTGGACTTTGACATTGTGTC
GTTCCATGCTCCGGAGATCAATGCGAGCATCGGGTTTACCTCTGTTTCCGGGTCCGTCACGTTCATAGTGTAGTCAGGAGCTACACATTgtcaaaaaaaa
aaatcagcaCTCAAGCAGCTACACACATTTCACAACAACTCCAGTGCAATACGTACTTGTATCAGCGTTGCCGATAATTGCCGTGATATCCAGCGTCGTG
GCATTGTCGACCGAGTAATACTTGGCCATAGTTTccacgttctccagcaccgctTCAGCAAGATACTCGTCCGATAATTCTCCATGCACCGCGTGGTCCC
CCGTATAAAGGAAGAAGTCCGGGTCAGGCAGCAATTGTTTAGCATACTTCAGTGCCGACACCAATAACTTAATAGGGGCGTCGTCACCGTAGACGACGGG
GATCTTGGCCGAGTCGGTGGCGTTGAAAGATTCCGAGATGTTGAGGTGAACATCCGAAAAGTGCAAAATGTGCCGCATAGTCGTTGCCCCCCCAGCCGCG
CCGACATCAatgttgccgctgctgttggtt