Description :
From Genome Similarity Track
Location :
Scaffold_2231:789- 4306
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2231-snap-gene-0.2Conserved oligomeric Golgi complex subunit 8
Pytiw_DAOMBR242034maker-piw_contig_2231-snap-gene-0.3Hydrolase

Sequence
3517 bases(100 bases per row)
TTGACTGAAAACTGAACTTGTGTCGGACGGATCAGAGTCTTATTCCCGAGTCTTATTCCCGCTTGTTGTTCCACGGATCTTGTGGACAGGACAGATCCAC
GACCAGCGAGTTAGGCTTGATTGGCATCGGCCCATGAGCTTTTACGAGTGCTGCATTTGTGGAGCTCTACGTGGCTTGGCTCTGGAGAGACAGGTTGCAC
TTGAGCGAGCAGCTCCATCCCCAGGCAGCCCATAACAACATGCGGTTTGCCAGGTCTGCGAATGAGATGGCTGCGTCACGATCCCACTCCACTCCAAGAC
CTGTCTAGCTTAGTAACCAACCTCGTATCGATTTATACAGTCAAGTCACGAATTTGTACTTTAATGAACCAGTACAGTAGAAGTAATACTGCATCCACTC
GTAAAAGTACGATCCCATTTTTGCGCTTTTTTCAATAGACGTATCCAAGACAGATGAATATGACGACGATGACGACGCCGGCGGCGCTGCGCGAGTGCTC
GCTGGAGGAGCTGCGCAAGGAGCCGTGGCGGCTGCAGATCCAGGCAGAGAACGCGGTCGAACAGCTGCGCAACCTCGTGCTCAAGAACTACCACCTCTTC
ATCCAGAGCAACCAGTGCTCGGCCATCGTCAAGGACGACGTGCGTGCGGCCTACAGCAAAGCAATCACTCGGGTGCTCACATTTGTTTTGGTCGAATGAG
CAGCTCATATATACTTGTGTGTATAGCTGACGCAGCTCAAGGACGAGACGGACGAGATCGTGAATTTGATCCCAGAGCTTAAAGCGTACTGCGCGCGCTT
CCAGCACGAGGTCGCGAGCGTCGTCGCCAAGCATGGCGACATCCAGTTTGTCTTTGAGCACTACCTCCAGGTAGCTATACACACAGCTATACAGTCGATA
TACACGTGTGGTCTCTTACATGTGAAATTTGTACAGTTGACGGAGCTCCTGGACATCCCGCAGCTGCTGGAGGCCTGCATCTACAATGAGCTCTTCGACT
CGGCGCTCGACGTCATCCAGTTTGCCAACGAGACGTTCCAGACACGCGAGGGCCAGGCGACGCCCAACTTTGTCATCGCGACGCTGGTATACCTTGTGTA
TACCTGCTCATGTTGTGCGTGTATAGTATTGACCTCATATTCGACATTGTTGTGATGTACCTAGGTCCGCGAGGTGGCCCAGATGGCGAGCATGATGCGT
GAAAAGCTCCTGCAAAAGCTCCGCGAAGACCTCCAATTGGCGCTCTGCGTGCGCACCGTGAGCTACTTGAGGCGTCTCGATAGCCTCGTGGGGCAGCAGA
AGAGCAGCGCTCCTCCGGTTGGCACGCCCGAGTACGAGAGGCAGCTCAAGGACGAGTTCCTGAGCTGCCGCAACGTGTGGCTCTCGTCGCTCAGTCGGGG
CGTCTCGGCCGCAGACCCTTACCAATACGTACGTTGAATATATAGTCTACCTGTGTGTGGCGAGTGGTGTGACTTAACTCTTTGTTGTGATGGTTGTAGA
CGATTCAAATCATCGACATCAAGCGCACGAGCTGGTTTGACATGATCACGCAGTACTCGGCGATCTTTGGCAACGAGGTGCGCTCCCGTTTGTAGCAGGA
AACAACATCGTCATGGCTTGTATTGAACATGCCTTCTGCTGAACAGACTGTGGATGGGAAAGTGGATCCGCCGCTGTGCCGCTGGGCGACGACAACCGTC
GCCGACTTTATCCAGATTCTCATGAAGTAATGGGCTTGCGTTCTCTCTCCTTAGAATCTTCGCTTGTTAACCTAACAACTAATAATGGCTGAAATTGTGG
AAACTGGTTTTTCGAACCTAGACAACTGCCCAAGATCGACGACTTCAGCTCGCTCGCAACGATCCTCGAGCAAAGTTTGTTCTTCGGCGGCTCGCTCGGC
CGCGTCGGCGTGGACTTTCGCGCGATTCTCGTCGTGTACTTTGAAGACCACGTGCTCGAGCTCATGGGCACGCAGTGGCGCGCGGCCAGTCGCGCGTTCC
AAGACACTCTCAACGCGCACGCGTTGCCATCTTCAGTGAATGGCTCCACCACCTCGTCGTATTCCAAGACGCCAATCGTCATTGCCTCGTACCGGTCTGC
TGCGTATGCTGACGGCTCATCGAACGGGGTCTCGCCGTTCGCCTCACGAGCAATGGCTGGTGGGGAAGACTACTCACCACCACACGCGCTCATGGCGTTC
CCGATCCTCGCTGAGTTCACAAACGCGCTGCTTTCGTCGTTGAACGAACTGCGACTGTGCACGATCGCGTCGCTGCAGACGCGGCTGGCGAAGAAGCTCC
AGAGTACGATCTGCAGTCTCATCCTCGCGATCGCGGAGTTCTGCGAAGACAACAAGCTCCGGATAAGTGAGTCGTTGACACCACTGACCAGCAATGGCCA
ACAGAACGGCAATGGCGGCGATTTGACCCCAAGCTCCAAGCGACAGCTGCTCACCGAGGCTTTGCAGAGCACAGTCGAGGTACACTGACTAGTTGTGTAT
GATACATGTGAAATGCATCATTGTTTACTAACACGCCTAGTGTATCTATCTGTCTTGTAGATCCTGCGCAAGGAGCTCATCCCGTACCTGATCAAGTGCT
TTCATCGACTCTACGCGAACAAGGCGCCGTCCGCCACACTGCTCGACATGGTGTACTTTGACACCATCATGCAGGAGAATGGGCTGCTGCCACAAGACAA
CACGAGCCCAGCAACCTAAGGTGACCCGTGTCAGTTGCTAATCCATCATGCTGTCAACCACAATGGTACCAAACCAAGGTCCGTATCCATATTACGTGTT
TATCTATGATAGAGTCCAGTACCTGCAGTCACAGGGTTTCGCTAACGCCCAGCAGCCTGCGCTGGGAACGACAACACCAAGCCGTCGTATGCCATTTCGA
TGATGAGCCCTTCGTCGTGACTGATCTTTTGCAGCAAGATGCTGTCGCGGGTGTAGTCGAGCTCGTGGCTCATGCCCGTGAGCAGCGTGCGCTTGGGGCG
AACCGACCGGACCTCGCGCACCACGTCCTGCAGGTTCATGTGCGTGCTGTGGAACTTGTCGACGTACAATGCGTCGATGATGAGCACGTCGATCTGCGGC
CGCGCAGGGTCGTTCAGCAGCGCGCGCGCCTCGGGGGTCAGCTCGCTTACGTCCGAGATGTACACGAAGCGTACGCCGATCTCCCTGCCGAACTCGAACG
CGTTCGAGATGTACCCCGCGCCGTGGATCACGGGGAACGGCAGAATCTCAAAGCCGCAGGCCACGAACGGCTCGAGAGCATTGAAGAGCTGGAAGCGCGC
CTTGGCGACCCAGCGGAACGGCGGCGGCTCGGCGCCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN