Description :
From Genome Similarity Track
Location :
Scaffold_3896:789- 2544
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3896-snap-gene-0.3Fumarylacetoacetate (FAA) hydrolase

Sequence
1755 bases(100 bases per row)
GCGAAGAAAGCTGTGGATGCTGCCGTCGCGCGTCCTCCGAGCCTCGTCCCCCGTTCTGCAGCTCACTCGCCAGCGTCGCAGCACCACCAGCACCAGCACT
TCCGTCTCCATGTCCTTCGCTACCTCCACCGCCTCGCGAGCGACCGCCGTCGTGCGCTTCGTCGACGCCAGCGGCACGATCCGCTGCGGCCAGCGCGACT
CGCAGGACGCCACCACGGTGCGCCTGGTCGAGAACAACGACCCGCTCGGCAGCCTGCGCTTCACGGGCGAGCGCGCGGTGATCGCCAAGCTGCTCGCACC
CGTCGTGCCGACGCAGATCCTCTGCATCGGACTCAACTACCGCAAGCACGCACTCGAGACCAACATGCCCGAACCAAAGTACCCAGTGCTCTTTTCCAAG
GGCCTCAACGCGCTGCAGCACCCGCACGAACCCATCATGATCCCGCGCATCGCGTCGAGCCCACCAGAGGTGGACTACGAGTGCGAGCTCGCGGTCGTGC
TCGGCGAGACGATCAAGGACGTGAGCGAGCAGGATGCGCTGAAGTACGTGGCCGGGTACACGTGCGCGAACGACGTGTCGGCGCGCCGGTGGCAGGGTGC
CAAGGGCGGCAACCAGTGGGTGCGCTCCAAGGCCTTCGACACGTTCTGCCCCATCGGGCCCGTCATGGTCACGCGTGAGGCCATCGCCGACCCGCAGGAC
CTCGCGATCGCCACGTACCTCAACGGCAAGTGCATGCAGCGCTCGTCCACGCGCGACATGATCTTCTCGGTCGCGCAACTCATCAGCCAGCTGTCGCAAG
ACACGACGCTGCCCAAGGGCACGCTCATCCTCACGGGCACCCCCGAGGGCGTGGGCTTCACGCGCAAGCCGGCGGTCTTTCTCGCCCCGGGGGACGTCGT
CGAGATCGAGATTGAGAAGATTGGCCGTCTCATCAACTCAGTCGTCGCGGCCTCCGCTCTGTAAGTGGAGTATTGCACCGGTACGTACTCGGCGCTAGTA
AGAGCTTTGCGATGTGAAAATGTTGTTGCTTTCCAAGTCAGTGAGCGTTTATCAAGCCCCTGAGAAGTCTCCCAGAAGTGCGGATTTGAGTCAACTCATT
TATCGAAGAGGTATTTCCTGAAAAAATCGCCCATCATTGACTGATGTTTGAGCGGCGACGTGTTCTTCTAGGTCGCTGCTGCTCATCAACCGCGACGCTG
CTTGGGGGCATGCTCGTGAATGCGGGAGAGAAGGTGATGACTACTGGGATCGCAAGTCGACAAGATTTCAAGACCGGACGGCACCAGCCGTGTGTGGGGT
AGTATGAATCACCACATCGGGGCTGTGCAGGTGGACTGACGCACCCGGAGTCGACCTTTGCCATCCAATCCTGTCGTGTATGAAACCTGCTACGATGTTG
CCGCTCTCCAGTATTCTGGGTGCATTACCAGACTTGCGAAGTCGACACTGAGGTTGATGTCTAATTGAGCTTTGCGTTTGAGTTTGCAGATGACCAGCTC
AACATCAGAATTGGTGGTTTGAGTCTAATCAGGTGACAGTGTCACTGTGGTGTGTGTGTATGTGTGCTTCGTCGCCGTTCGTCTACTTGGCGGTCCCAAG
AAAATTCCGTCGCTTTCATGCTGTACGGCAGCCACTCATCCACCAAACGCAGTCTGCAATTTGCCAACTCCCAGCGAAGTCGAGTGCACCCGAGCAAGCA
CTCCCACACAAGCCAACAATGAGAGCCCCGTCGTCCTTCATCAGCGTCTCGGCGC