Description :
From Genome Similarity Track
Location :
Scaffold_2231:789- 1917
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2231-snap-gene-0.2Conserved oligomeric Golgi complex subunit 8

Sequence
1128 bases(100 bases per row)
TTGACTGAAAACTGAACTTGTGTCGGACGGATCAGAGTCTTATTCCCGAGTCTTATTCCCGCTTGTTGTTCCACGGATCTTGTGGACAGGACAGATCCAC
GACCAGCGAGTTAGGCTTGATTGGCATCGGCCCATGAGCTTTTACGAGTGCTGCATTTGTGGAGCTCTACGTGGCTTGGCTCTGGAGAGACAGGTTGCAC
TTGAGCGAGCAGCTCCATCCCCAGGCAGCCCATAACAACATGCGGTTTGCCAGGTCTGCGAATGAGATGGCTGCGTCACGATCCCACTCCACTCCAAGAC
CTGTCTAGCTTAGTAACCAACCTCGTATCGATTTATACAGTCAAGTCACGAATTTGTACTTTAATGAACCAGTACAGTAGAAGTAATACTGCATCCACTC
GTAAAAGTACGATCCCATTTTTGCGCTTTTTTCAATAGACGTATCCAAGACAGATGAATATGACGACGATGACGACGCCGGCGGCGCTGCGCGAGTGCTC
GCTGGAGGAGCTGCGCAAGGAGCCGTGGCGGCTGCAGATCCAGGCAGAGAACGCGGTCGAACAGCTGCGCAACCTCGTGCTCAAGAACTACCACCTCTTC
ATCCAGAGCAACCAGTGCTCGGCCATCGTCAAGGACGACGTGCGTGCGGCCTACAGCAAAGCAATCACTCGGGTGCTCACATTTGTTTTGGTCGAATGAG
CAGCTCATATATACTTGTGTGTATAGCTGACGCAGCTCAAGGACGAGACGGACGAGATCGTGAATTTGATCCCAGAGCTTAAAGCGTACTGCGCGCGCTT
CCAGCACGAGGTCGCGAGCGTCGTCGCCAAGCATGGCGACATCCAGTTTGTCTTTGAGCACTACCTCCAGGTAGCTATACACACAGCTATACAGTCGATA
TACACGTGTGGTCTCTTACATGTGAAATTTGTACAGTTGACGGAGCTCCTGGACATCCCGCAGCTGCTGGAGGCCTGCATCTACAATGAGCTCTTCGACT
CGGCGCTCGACGTCATCCAGTTTGCCAACGAGACGTTCCAGACACGCGAGGGCCAGGCGACGCCCAACTTTGTCATCGCGACGCTGGTATACCTTGTGTA
TACCTGCTCATGTTGTGCGTGTATAGTA