Description :
From Genome Similarity Track
Location :
Scaffold_762:7886- 10421
Transcript NameFunction/comments
g16517.t1hypothetical protein

Sequence
2535 bases(100 bases per row)
TTCGTTCTTCGTCGTTGCTTACGACAGCTGCCACGGCTGCGATTGTAGCACCTGTCACTGGCGCTGCCAACCAAGGAGAGACACAGCTACGCGAAGAAGA
GCAGCGGTACCGCTCATTAAAGAGATGCATTGCTACAATGTCGAAGCACGCCGGCAGTGAGTCCAAGATCCCCAGTGTTGCAGAGTGGGAGCTCCAGACG
ACTGGACTGTTGCAGTGCTTGTCAGAGTTCACGAGCTCTTTCTCCGAGTGCGTCGCTGCTGGTGACTTGAGCTGTACAGCAGCTTCCCCGTTGAAGATGA
CTGGTCTCGTGCTGTGGGATATCGTCTGGCAAGCTACCACATTCTGCCTGAAGGTTTTGGGATCGTCACTGGATGTGTTTGCTGTGTGCGAATTGCTCTC
GATGAAGGAGGGACGCATTGAAACTGTCGAGAAGGTGTTCACTCAGTTCGTGGCCAAGTTTGTGGCGGTGCTCAAAGTGACTGTGCAGTCTATCGGACAA
AGCCTGAGCGATGACACTGCAGCGTCTCGGCTGCGGTCCATGCTTGCCTTCGTACTGGCCTACGTGGTGGAACTGCCGTCCGGGCGACTTGCTGCGTGCG
CTGACGGTGATGATCTCGCCAGGCGCTTTGCCGTCCCGGCAAGCTCACAAATCGTAGCAGCATTGCGAGATGTCGTGAGCCTCGGAGAGCGGTCACGAGA
CCCATCTAGACTAGCGCCTTCGCCCTCCTAGGCCGCAACATGACAAACTAGAAGTGCACAATAGAATACATGTAACAATTACCCTATCGAGATCCAGAAC
TAACAAGCGTGGCTTTCACTACAGTGGACAAACCTACCAAGCCGTCTTACCAGCGCATTAAGCAAACATATCTGTCTCCCACAACATGGAGTCACTGTCG
ACCTGCCCGAGTTCTTTGAGTACCTGACGAACTTGAGCGAGTGCGGCTCGCCCTCAGCAGCGACAGCACATTGCTGAGCCACCACATCTCGCCAGTAAAC
GTCCGTGTGGCAAATCGCATCCAGCCGATGTCCGTTTCGATCGGTTGCAAAAACGGATGAAGCCTCTTGCTGACTCCACCGAGATGGCACTCCAGCCTGT
AGCTCCATTCTCGATTTACACGTGGCGATGACAGAGACCCCAAAGCGACAGGAGTTCCCAGAACTCACGACAGCTCTCGTTGTCTGTCGCGAATGTCTCT
CGAAGCGCAACGTGGGATCGCTGCCTCACGCCGTGACGCTTGTGGACCAGTACCTAGATCCGTTCTCATCGCGCAAGAAAGTTGGGCGTGCGTGCAGATT
GGGGCTGCCGAGACGAGCACTGGAATATGCAGCAGCTCGCGACCCGGACTGGGCCAATGGTCAGTACATGGCAGCGGCCGCTGTCACTCGAGGGTTCGTG
CACGTCCTCGAATGGCTGAACGAGTGCTACCCAGGACGCACTTCATGGGGTGAAGGCCACGAAGGATCGAGTCGCTGTGGACGATTCCTCATGGACACGG
CAGCGGAACATGGCCATCTCCCTGTTATGCAGTGGTTGCATGCGAACCGCAGTGAAGGTTGCACGTATCGAGCCATGAACTACGCAGCAGCCAGTGGTCG
ACTAGATATGGTGCAGTGGATCCATGACAACCGCAGTGAGCCTTGCAGCACGGAGGCGATGGATTATGCTGCCGGGAAGGGCCACCTCGATGTTGTGCGC
TTCCTACACGAAAACCGACCAGAAGGATGCACCAAACACGCCATGAGCAGTGCAGCGGCCAACGGCCACTTGGTCGTTGTGCAATGGCTCTACGCGAACC
GGAGCGAGCGGATGCCGGCGAATGCGTTGCGTAGCGCCGCCAAGTACGGGCATCTTGAAGTGGTCCAGTGGCTGGTTGAGATTGTCTGTAAAGAGTCCAG
AGGGGACTCGTTCATTCAAGATGCGATCCGAATCGCATGTCAAGCAGGTCACGTCGAAGTGGCACGGGACCTTGAGCAAACACTCAAGCAAATGTGACTC
GAAGCTACCATACAACTTGACTATTAGCCAGAATCTCGTTTCGACAAGGCGTGGCCAGCAACGCTATGACTCGAGAAAATAGAGGCTCAAACTTGAACAA
ATAAGGGAGATTGTATCATTCTTTATTGCGCCACTGATGTAGCTCAATCTCCAACATATTACTAGCAGTAAGCCATGTCACATCGGTTTCCTCTCTGAGT
AAAAGCCATCCTCCATTTACTTGTTCTTCTGGTGTGGTGCTGTTATGGTATTGCAGTCTCCATTTGGCGAGAGCTGGAGCTGGGTTTGTCGGTTCGATGG
TCGTCATAATGCCGAGGCATAGACCTTGGATCCTTTTGGTGTCGCTTCGTTTCCACATGCTTGCTATTGCCATAACTTGGTACGTTCCAGCTGCTTCGTA
TCCTGGATTGAGATTTCTTCATCCTCAAATTCAACGGTACATGTTCATGTTCAAGCTCAAGCGCGTGCACTGCGTTGACACCGCTGCTGTGACCCCCCTC
CAGCACAGCCACGCCCGTGTATCTCCGTACATGCT