Description :
From Genome Similarity Track
Location :
scaffold_18:7886- 10181
Sequence
2295 bases(100 bases per row)
TGACGGTCGATGCAATGGATGCATGCCGAAACACTGCTCCATGAGTTGACGGTGTGCTGTCGGTAATGACGAAGGAATGGGAACGTGGTGACCTTCCAGG
ATAAGAGCTGCTGCATCTCGTGACGACAAGTTCGGGAACGGAGGTTGACCACTGAAAATCTCGTAGAGAAGAACACCAAACATGTACGAATCCGAGTACG
TTGAAAACAAGTGAGGTGGCGTTATGGACTCGGGTGCCATCCACTTGAGCGGCCCGAAGCCATGACGATCGTCGTCGAACATGAATCCTCCAAAGGATCC
CTGACTGTCACTCAGTCGCCGAGACAACCCGAAATCGCTCACTTTAACGCTGAAATCGGCATCCACCAAGCAATTTCGTGCTGCGATATCGCAGTGTAGG
AAGTTACCCTGATGAATGTTCGCCAAACCATGAGCAGCATCTCGCGCCATAACCGTACGGGAAAACAAGCTGACTGAACTTGGCACTGAATGTGCATTGA
TCCCTAAAACATCCTCCACGCTGCCATTAGGCAGATACTCGGTCACCAGAGAAATACTACGCGAGCCGAAAGTGCTATTGTCAGGTCCTGTGCTGCTGAC
TCCGAGAAGCTCTACGACATGGGGATGTTTGCCCAGTAGATTCATCACGGCTGCTTCGTGTTGAAACTCAGCAAAGGCATCAGCATTGCGATACACGTCA
TGATTCATCATTTTGACAACCACATCCTGAGATGTGCTTTTCCAGCGTGCAAGTACTGCGTCGCCAAATGCTCCGTGACCAATTGGCCGGATGAGCTCCA
GATCTTCCTCCGGAATGTCGAGAACGTTTGGTGCCACATGTTCCATATGACCATCCAAAAGTGATAAGTCTGAAGAGCTTGTCGCACCCGCAGCAGCATT
ATAAACGTGTGATGTGACGGTTTGGAGGCGAATGTAGAGCAACGATACTTTAGTCCCAGCAATAATCTTGGCAATACAGAGCTCGTCATCGTCTTCACTA
TGTGGTCGTGGAAGAGCACGATAAAGATCGAATGACACGCGGTCAATATCGCCATGCCATCGAAATGACTTGCAGCTGTCACCCTTAACACCAAAACGCG
CGCTGGGCTCAATCGACACGGTAACTAAGGTTCCTCGCTGAATATGAAGTGGCTGCACGCGCTGCCCGTTTTCAACATCGTTGTGCTCTAATGCCACTTC
CAACATTGACTCGCGTTGTTGCTTCAAGTATGCCCAAATGTCAATGCGGAAGAAATCGCACAGCGCGATTTGTGAAGGTCCAAATGCACTGAAGTGTACA
GCATCGTGTGTGGCACTCCTATCATAACCAAATTCTCCCTGCTCACTTTCCGTAGCTGAACCTGTTCGTCGTTTGAATATATCCTCGAAAACGTCTTGCG
TTGTACTCTCGCTATGATTGTCAGTCGCTTCATATTGTAGCGAACGAACAACATCTTTTTGAAGAGCTCTGACATCATCACCGTCACGAAGACTCGACAG
CGACGACCGCTTTTCCCCAGGTGGGAGTGATATGAACTCCCCTTCACTATCTTTTTCTGATAATCTCTCAACATCATCAAATTCAAAGTTGTCGTATGAC
ACCGCTCTGGGAGAAACATACAAACTTGGGAAATCATAGTCAAAGTCGTCGTAGGCTCTCCAACCCTTTGAGACACCATCATCACCTGGACTGAGCTCAG
GTTGGAATGTGAATAGATGTCGACGCTGTTCTCCATCACCACTCCCACCTTGTGGAATGAGTGCATGCCCTGCTGGAACGGGGACAGGAAGTGGCCCTCT
ACGAAGCACCCCATTCGGGACATACAGCCTAGATCGCGTATAAATGCGGCGGGTAGACCTCTGCGGATATGATATACGCGTAAGAAGACTGCCAACTGTG
ATCAGTAGGATAAGAAAAAAGCGTACCCGGCTGCGTTGACGCGAGCTCTCGTTCTCCTCTTCTTCCTCCGCACGTTTCACTTCAGGAACCTCGCGAACGC
TTTTGAGCCAATCCATCATACACAGCGCTGCTAACTTCCACAGCAATGATTTGCACAATGCATTCCGCGACTCCGGGGAACTCAAAGTAATTTCCAGTTT
GTGCGTTGTGTGAAGGAAGTCCACTTGGCGTAACCATTTGCGTGCCAACAAATCCTGCACACTAAGTTTCGTAGCTACAGCAAACTCCCATGGTTTCATG
TAAGTCTTCAGCATAGTGTGAAAACACAAAATAACACTTACTGAGGCAGTCAAGCAACAGGTCACGACACGCAGGCGATAGATGATCTAACTGAT