Description :
From Genome Similarity Track
Location :
Scaffold_191:7885- 14269
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_191-snap-gene-0.21Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_191-snap-gene-0.22Histone acetyltransferase

Sequence
6384 bases(100 bases per row)
TGCTCATAGACTCGTCGTCGACTACTTCTTCGTTAGTGCTCGCGAATGCGACAAGACTCCGCATCGAGCAGCTATTGCAGAAAGACCTCTCCGTATTTGA
CTACGCGACGGGAGAGCTGCTCTTCTGCTACGATCAAAAGAGTTTGTCTTCTGATTGGACGGAGCGCATGCTCGTGGACGCACACAGCAGACCAGTCGTG
AAGATGCAGAAAGAACTCGTCTACGACAAAAAATACCTTCTCACAGCGACGGAAGCAACGGTCACAAGAAGCAGCAGAAGCCCTGCAAGCTCACGTCAAA
CATTCACCATGGCGTACTGAAAATGGAGTTCAAGCTCACGGAGCCGAACGGGCGAGAAGGTTGCCATTTCAGTCAACGGCGACTGGAAGCTGCGCAAAGT
GGTGCTGTGGCTGACTCGTGGCGGTGGAAGCAAGAAGACCTGCGAGCCGATTGGGACAATTGCATAGACACCTGAAGCTGTGGGGTACGATGTGAACGTG
GCGTCTGAAGTGGATCTCACGATCTCAGCGCTCTTTACCATCGTGCTCCATGAGACGGTGACCGAGTTCCCCACGTTCACTAGCCATTCATTGTAGCACA
AAACTCTCGGGTTTCGAATTCCTCTCACATTTGGCAACATGCGTCAACGATTCATCTCTTGGGAGCTAAATACACCATCGCCAAATATCAGAACTTGTAA
CTTCCACGAGCTGTAGAAATACAGCTCCATTCCCAACAAACGACCATTTCAGTCTTGAAAGCCGATTTCTTCAAGCTCGTGCAGTTTTCGATACTGGTAC
GTGTACTCGAAGCCGCTCTTCACAGAGTAGACCAAGAACTCGTCCTCTTCGCCGTCTCTTGTGTCAGTCAGTTTTGCTTTCACCTGAGTTCCGTCGCGAA
GCTCTCGGCCGATCATCGGGTCGTCTGAAGCGAACGCAATCGGCCGCTGGTCTTCCAGCATGCCATGAATATGCACGCGTCCGTCGACATCGAGGACCAG
CTCCGCTGCAGCATCGCCGCGATTGTCGTCTGCCTTCATGTTGCTGTAGCTGGTGTCACACATGATCACTTCTTCAAAGTAAGAGTTCAAATCGCCAGCA
GCAGCAGACCGCTTTTGCTTGATGACCGTCGGACAGTTGCCGTGCGGAGTGTGGCCAACAATCAGTCGCTTGATGCCGTTCTCCGACAGCATCTGCACCA
AGTCTGCTGGTAACTGGGTCGGCATCCCGGATGACTGCAAATGTCTCCCCATGATCACGCTCGCTGGGTAATCTGGAAGCGCGTATTTGAGCAGCTCATT
TCCGCCACGGGTAGTGCGATCTGGAGTCCACGTTGGCTGGTCGATCCACTCTTGCACCTGGCTCCGATACCATCCGTTGAGTTCCTGGACCCACTCTGAA
ACTGACCGAAGATGGGTTGATGGTGCACTGGGGATTCGACCAAGAGAAGAGACGTCACCATTAGCGCCTGCGATGATCCCTCCGTGAACGAACAACGTGT
CGTGCGCGACGAACGCGAGGCTTCCCAACTCAAGGTACTCTCGAAGCACGCCACCCCTCTGAACGCTGTCCAGATACGACTGCAGCACACTCTCGTCGCT
TACTGATGTCTCTGAGGCGTCGTCGACTCTCGAGGCGATCTCTTTTCGACGCCTCTCAAAATCACCCTGCGCACCCATCGTGTGCTCCAGCATCCACTGG
AGTCGATTCACTTTCGTGTTTGCTACCTGAAGCAATTGATCATTCTCTTCTGTCACTTGGCCACTGTCGCCTGTATCGCCAGACTGCGGTTTCTTCGCTT
CACCACTAAGTCGACGCGCAAGAAAGTCTTTGATGGTTACTCGTCTCTCTTGAGGAACCCAAAGCGGTCCTTCGCGGATCTCTATTGTTCGCAGCAGATG
CAAGCGAGAGCCACCGAATGATGCGTCAATTAGGCAGCAACAACAATAACAACAGTAATTCTGCAGCTACTGCACCTTTCGCCATCGTGTCAAAGTCCAT
CTCGGTGTCGTCCAGCTCAGACGTGAGGCGCATCTTGTTTGCGTCACGGTTGCCCACGAGCAGCACCACACGGTCCGGATACTTCTTCTTCAGCCGCACC
AGCTGCTCATAGCATCTATCCACACACACACACACACACATCAACAGACGTCAGACACCACGACGAGACAGCAGGATCAACAACTAAGGGCAATACGAAG
CACGCACTGCAGAGTCTCGCCAGCTTTGTCGCCAGCGTCGCCTCCGAAGATGAGGAAACAGTCGTCATTCAGCTCCAGTTGCTCTTCAATTACCGCTTGT
GCTGCTGCTCCCGTTGCTCTAGTTGCTGTCTGTGAGTGCGCTTGATCGGCGAAGCGCAGACACGTCGACTGACGCACGAAGTTACGCACGTAGGTCCAGT
TGCCCTCCACGTCCGTTAGGAAGCACACGCGCCGCGAAGCCGCCGCCGCTGCCATCGCTTTCGCTGCTGCCATGTTGCCTTGGCGCTCACCCCGCATTGT
GAACTGTGAACCCACAACGACCAATTTGCAAGGCGAGCACCAGCAAGATCGCAATTTTCCACCAATGAGTTCTCATTTCTTATATTTTCAGCCAATAGGG
CGTTATTTTTTGTTTGTGAAGCGAAATCCACAATGAAAGCTTTTTGACCAATATTTTCACAGAAATTCACCTCAAAACCTTGATATATTAAGGTTTTAGA
AGAGGACAGATGTAAAAATGAGGTTATATTAATTCAAAAACAAAATCGTAGTTTTATGATTTGAAATTCATGAATCTCTATTACTGTTTAAAGTACTATT
ATATTTCAAGACGGCGTAAGACAACACCATTGTAATTATAGCCTGTCTTTTTCATTTCTCCAAACTATATACCATTACTGACCGTGAACAAAAAAATAGA
GGCATCTTTCTAAACAGTAACATGCTTTGTATAGATAGATAGAGGTTTGCCTCCTTTTGCTCGGCGCCATCAAAATCCGTCAGAAACGCACAAAGCAACG
GACATGATCGGAAGCCGCATCGCCGCGCCAGCTCTGCGCAGCGCCTTCGCGCCGTGGACGCTCGCCTCCTCCGCTGTCGGTACGTCTCGGAGCATAATGC
GCACATAGAGCGCTCTTCGATCTGTCCGTGCATATTATTTTCGCTTCGAGTCCCCTTCCTGCATTGCAACATTGTGTGAGAACGAGCAAGTGTTGACGTA
TGGATGCGCATTGTCGTCCATCTGATGCCTATGGTGATCTGCAGCCCGCCAGCCAGCGTTCTTGAACAACATCGCTGTCACTGCTAATGCTTTGCCACTG
CGTTTCGCGAACGCCAACGTGCGTGAGTCGCTCGAGGCCTCGTTCGAGCGCATCCGCCTGATGGAAGAGACGCCAATCGCCATGGAGCTGCTCAACCGCA
ATGCTCGCCGCCCAAAGAAGGTGAGACGCCTGAATTAAAAGCATCGCGCATCTGTTGGTGATAGAAGTAATGGTGCTAATTAGTGTGCAATCTCAAACGA
CAGGCGAACCACGGCAAGCGTCCATGCTCGCACGTCCGCCGACGACAGAAGCGTCTCAGTCGCCGAACCGCATAGACCGTTTAGCGCTGACACAACCGAT
CGGTTTCCTGTCCATAGAAAGAGAGAGAGCAATGCCATCGCAATGCACATGCAAACCGGAGAATAAACATACGACGTTCTATCATCTCTGTTCTGTTTTG
TCTTCATAACGTGCTATATAAGCATACACATACACACGTTTCTTCGCTCTCGGCTCTGTTCCACCGAATCCTAGCTTTCCTATTGTCCTATTCAAAAAAT
TAACTGTCAGCAATTGTTTCCCCACTTGATATAACTTTACTACTACACACGAGCAGCTCCACACATCGTCACGCACGCATCCCTTTCGTCAGAATCACGC
TCGTCATGCTCCCATCGGCTCGTCCTCAGCGCTCCCGTTCGGCTGCTCCTGGGCTCCGTTTTCGTCGCCAGCACCGCCACCTTGCATCTGGCGATACTGT
TGCGTCACAGCCGCACGACGGCGATCGTCCATGAGCTGCTGCTGCAGCTGCAGCTTGCGCACGTGTTCGCGAAGGTCGTGACAACGGGGTACCTTGCACT
CGTATTGGCGACACTGGCGCGCGTGTAGTTGCAAAAGCGCCCACACCCTGCGACAGATCGTGCACCCGCCGTACGCGCGGAGCTTGCACTGCGCGCCGTG
GCGCATCAGCTCCTTCATCTTCTCGCAGTTCGACGAACCGCAGTTGCCGTCTGCGCAGCTGCTCGAGTGCACCAGCAGCTGCATGTGAAGACGCACGTTC
TTCGCGCGGTGCTCGCGCAGGCGGCGCTGCTCTTCGGTCAACGCTGCGCCGTTCGCACCGCTACCATTCGCGCCGCCGCTTCCGCCTGCCGCGCCGCTGG
TTGGGATCATCTCGAGCGGATGCTCGTGCTTCTCTTTCTCGTAACACGCGTCGCACACGTCAAAGTCCGGACACGTGTGGCAGTGCCAGCGGTTGCCCGT
AACGATGTCCTGCGTGCACGCGTTGCATTCATAAATATACGCGTTCGGATTCGGGTTGCCTAGGTGGTAGAGCGCCATCATAGACGAGTGCTTCGCGCGC
CGCAGCTCGTCGAACTGGTAGTGGTTGCCCTGGCAGAGGCTCAGAAACGCCTGACGTGTGTCGAAGAACTCGCTGTCCTTCACCTCGTCTGGGTCTGTGA
TCTTCAGCGGGATGTTCATCTCCACACGCATCAGCGCATTCAGTCGCGTCTGCAGCTTTGGTGTGAGCTTCGCCTTCTGGTAACATGCGTCGCAGAGCAC
GGTCTGTACCGTCTTCGGGTTTAAGCACACCTCGGTCTTGGTTTTGAGGTCCTGCCAAATTGCACCCTGTAACACCGTCGTGTTGCAGACACGACAGCAA
GGATGCAGCTTCACCACCAAAAAATCGTCTTTCATCGGCTCGATCACCTCGCCAAGCTTCACCATCAACGGGTCTGTGATCGTGCGGTCGACTGTATCCA
GTGATGTGATCGGAGCCTCTTTCTTGGCTTTCTCTCCATTGCCGCCTGTGCTATCGTTGTCTTCCTCGCCCGTGTCGTTGTCATCGTCGTCACCGTCGCC
GTCCGACAAGTTCCCATTCTCCCCGTCATTCTCGCCAACGCCCGGTCCCGTCTTGCGTCGCTTGGTCTTCTTTGCTTTCGACTTCTTGCTGCCTTTCTTC
GTACCCGCTGTCTTTCGTTTGGTTGCGCTTGCCTTTTTCGCCTTCTTGGGCTTCTCCGACTCGATCTTCTCAATTAGATCCTCAGCCAGACCCACCCAGT
AGTCGCCTTCAAAGTACGGCAGCGCGCACGCCGAGTTGTCGTCGCGCCAAAAGTCGTCGTACAAGTTTGTAATCTGCCACACCACATCCTCAGCTTGCGC
CTTTACCAGCATGTCCACGTACCATTGGCGCAGACGATCAGACTTTGGCGTCTTCTGGCTCTCCGGGTGGCAGTACAAGATGTAGTCATCACCCTTCAGC
GGTGGACACGCCCACAAGTGCGCCGTGTGGAATCCCAGCTGCTTCACGAAGTCCATGTACGCGATCAGCAGCTCGTGGTACACTTTCGTGCGCAAATGCG
GTGGCTCAAAGTAGTTGACAGAATCCAAGTACGAGATGTACACGCGGCGCGAGTTGCAGTCCGCTTCCTGCTCGTCAAACTCGTGCACGTACATACCAAA
AAGGAGCACCGACACGCCATGGATCTCTTGGAACATACAGATACACTTGGACTTGAAGCGGTGCTCGTATGTGTACTTGTGCGAGTCCTTGTACCGTTGA
AACATCTTGTCACGCACCATAAGCTGTTTCTCGATATTCGACACCTGGCGCACTGTCAGCGCTTCCGCAGTTTGAATGTCTTTCACATCTTGATTTGTCC
ATTTGGCTTCGTCCTCGCGCTCATCCTGCAGCGCCTTGTAGATCCTTCGCTCCAAATAGTCCGACAGCTTCGTGCGCATCAAGTCCTTCGCATTGAACGC
GTGACGACCAATCTTGTACTTTTGTGGCTCTTTCTTGCGGTGATCGAGCAGACACTCGGGGCACAGGAACTCACTCCCTGGCGTTGACGAAATTGAATGC
GCCGACACGACTGTACCTTCACTGCCCTTTGCTGTCGACGCTGGTCCGGATGGTCCTGAACTGCTGCCATTAGAACTCGCTGGGTTTCCCTTGGAATTCT
CGCTTTTCACTTGCTGAGGCTTCTTCTCCGCATCAATCTTGCCATTGAACAGCGCACAAATCTGGTGCACCCAGCGGTTACACGTGTCACACTGCACCCA
CGGTTCTTCATGCACTTCGTCGTTCTTCTTGCGAGAGAGCTCCGACTTCTTGTACACGCGGCCTTCGTTGTGCTTGACAGTCTC