Description :
From Genome Similarity Track
Location :
Scaffold_238:7884- 12977
Transcript NameFunction/comments
g11153.t1hypothetical protein
g11154.t1hypothetical protein

Sequence
5093 bases(100 bases per row)
CCGCGATCGTTTGACGCGACAGGATGGTTCGCGGAGTTCGTACAGCTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCGTGCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGACTCGGGTGCAAACAGCGTCGATCTCGAGCTGGCCCCGGTGGCAG
ACCATCCTCAAGCATTTACTGGCTGGGATGATCGCCGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAAC
GGTGCTTTTGGTACCCTGGTTTTGGAGCCACGCGGGCGCCCCCTGACTTAATCAACGCTCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAATA
TCGCACACAACTGAGCGACCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGATTCTGAGCGAAGTAACCCTCTCCGAGGT
CTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACACGACCCCGATCGGCCTCTTCCCTCCCCGATCGCAAACTCACA
ATTCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTC
CCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGACC
CAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCGTAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCA
CTTCAAACTCGCCTTCGTCGAGTAGCTGTCCTCCGGCAGGAGGGCTTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGACGCGTCAGGACGA
TCGGGAAACCTCCGGACCAACTTCAATTTGGGCACATGCACGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGTCGA
TCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCTAC
CGCGATGTTGTGGGACCGCAGATCTTCGTTGTGTCGGCTCTACCTCTGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTG
TACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGTGGGTCCCACCCATGGGCC
AGGTAGAATGGCGTGTCACCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTG
ACACGTACATCTTCAGCGATCGCGTGAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTTTCTGACC
CACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCT
TCGTAACTCTCGGCGATCGTTTGGGCAGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTC
CTTTGTACGACTTCGGTAGAGATGGAATATGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGG
GCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACACGCTGGTAA
GTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGAACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGT
CTCGGTCTTCGTCCGATTGAGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGCCTTAGCATC
GTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATG
CGTTGCACGATCGCTTCTTGCAGAACTTCCGGCGTTCGTCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGTTACAGCGTTATTATCCTTCG
GCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGCCGATCAGCTTCCAAGGTAACTACGGTTCCTTCGCCCCGTTGAAGAGCTTCGCTAGC
TAACTTGTCTGCGCTCTGGTTCCAATCTCGTTTCATATGTAGGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAAC
AGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGA
GATCGAAACACAACAACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATTCCGGCAGCTT
CCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCCTCGACCGTAGGGGGT
GGCATGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCA
GAATTTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGAAGCCAGCCGAGTTG
ACCAGCCACGCCAGCGTCGATTGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTT
CCTTGTCGACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGC
GGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTAGACACGATCTTGGCCTTCAGCATC
GTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTGCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAA
TCATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAA
GGATTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATATTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCC
AAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCAGTGCTTCAACCTTCTCACACA
GCATGTCCCACGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGACGATCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAA
CACGTCGATCGGTTCCGACGGATCGTGACCGGCGCAGATTCGGAAATGTCCATACAGCGCGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATTCTTT
AACCCGAACGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCCTCCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCAC
TTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGATACACCATCAGTCTCGTCAAACTATT
CACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTCGACGGCGTGATCATC
TTCGCCGATAACAGGCTTTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGACACGTTGTGCAACAGGAGCTGCTCCTCCCACAT
CGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTCCCCTTCCCGATCAGGAGATGTTTCCGCCTCCAAATTATCTGTCGCAGGCGATCGAT
TTCTTCCTGGGTGTTTGACTCAGGATCGCCCACCTGGATATCCTCGATCGTGACTTCCTCGGTGGTGGTCACTACTTCCGGCAAGATTGCCATCTGTCTC
TCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTCCGGATCAACGATCGGAGGCGTTTCGGCCTGGGGCA
TAGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTATCGCGTCCTGATCGCCGGTGCCACCTTCCTGATCCCT
TGGAGACCCCTCTGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCACGACGCAGGATTTTC
ATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTACCTCCACATGGTCTGTAGTAGACTGGAAAGCTAGAT
TCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCAAATGCCAACGTGGGTAT