Description :
From Genome Similarity Track
Location :
Scaffold_386:7884- 10815
Sequence
2931 bases(100 bases per row)
CGAGTTCAGCAACCATTTCAGCACTGAGTACCGCGTATAGATCACTACAGGGGACGCTGAACCGTAGATCAGTGGTCGGTACAATTCCAGATCTCTCAAT
AATGCCAACACCTCCTTCTCCGCAATGTGGTAGCGCAGCTCGAACTCGTTCAATATGCGTCCAGTGAATCGCACAGGCTGAATCACTCCATCATACATCT
GACCCAAAACTGCGCAAGCAGCCCATGGATTAGCATGTGGAATGATGACGAATTGCTTCGTGCGGTCCGGGTGACGCAGCAACGGGGTTGAGACAATCTT
GCGTTTCAGGATCTCAAACGCCTCTTTTGCGCGCTCAAGGTTAATGCCTGAACGTACTTGCTCCTCGGTCAACTCATAGAGCGAGGCGACCACCACTGGG
AGGTCCTCGATGAACTTGTTGTAGTAGTTCAAGCTCCCTAAGAAAGTTTGGACCCTTTTGAGCGTAGACGGAAACGGCAAGTCTTGAACGGACTTTGCAA
TCTTGGGTGTAGCTCGGATTCCTTCAGCGCTGATTTCATGGGAGAGGTATGGAATGGTCAGCTTGCCAAACTCACTCTTTGGGAGGCTCACGGAAATATT
CCAATACCGAAACCTGAACAAAAGTGCGTTCAAGTCACCACATAGCTGGTCCCAAGTCGGAGCACCACGAGCAATATCGTCGATGTAGGAACTGCGTCCA
AGCACTGGACCCATCTGCGAGGGGGCCAGGATGTTACGCTGAAACACCGTCATCTCATCGGTCAAAACGGGGACCACAGGCAAACTGCGTTCAGAGTCTT
CAGCGCATGTGCGTTCAGGGTCTTGACCGCGTGTGCGGTCAGTGTCAGGTCCATCCTGTTTCAGGAATTCCAGTACATCACGGTCGACGAGAGCCTCTTC
CTCGGGTGGCAGACGCACGAATCCCCACAGGCAGTTGTTGATCACAGCCTGGTAGATGAGGGGCGCGTTCTTGAGTCCAAACGGCATCCTGATCCACTGG
AAGTGCCCAAACGAGCAAATAAACGCCGAGATCAGCTTTGCGCGTTCAGTCATCAACACCGCCCAGAAGCCACTAGCCATGTCCAGACTCATAAACCACA
TCGCCGACTCAAACCCAATCAAAAGATCGTCGATCAGGGGAAGAGGGTACCGCGACAGCTTGATAAACTCGTTCACCACGCGGTAGTCAATACACATCCT
GATATCGACTCCGTTCTTCTTGAGTACGATGACGATCGGCGAAGCCCATTCCGATTCAGAGTGCTCAATCAGTCCCGTTTCAACGAGTTTCTTGAGCAAC
TCATAAACCTTGACCAGCAAATGTGGAGCAATCTGTCGCGCACGCTGATCCACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCG