Description :
From Genome Similarity Track
Location :
Scaffold_919:7884- 9005
Sequence
1121 bases(100 bases per row)
ATCGAGGACATTCAGATGCGTCTCAATGGGAAAGTCGATGGAAGGGTCGACGTATTGAATCGTCTTGGACTATTTGCTGATGACTCCCAGTCGAGAGCAA
TGACCATATCGTCACGTCTCCGACCGTCAGTGCAGCTCCGACTTGCATCCGACGCATAAAAAGGATCGCGAGATTTGATATTGCACCAGGTTCTGGAGGT
CTCGTAAAAATATCTCCGCTCAATTGATCGGTCAAGGTCTGACGTGTTTGCTAGGAGAATCGCATAGCCGTTTTGGAGAATGGATTGGGACATCCTACTA
AAGCCGATGAGGAGTTAAATTATACTATCTCTTCGGGATACGGAATAAGGATTGCAAACTGCTCGATGTCTTGAGGTGTCTTCTTGGTGAACGATTTGTA
GTAGAGTAGTGGAAGCAAAAAGTAGAGCCGATTGCCGCCCGGACCCAGTTTCGCCAGATCACCTGCCGCACCGCCCTTGATATCGTGACTTCTTCCCACT
GTCATTTGAAACCCACCAAAATCCGGCATCCACGCGTCAATGGCAGCATAATTCGATGTCCGTGGCACGTACAGCTGATTTGACTCTTGACCTCTTTCCA
CACGCTCCACTACTTGCCGAACGTGCGGCGACGCTGGAATATCGATTTTTTCATCCTCGTCACTATAACTTCGTTTGCGCTTGATTGAGTCCCGCCTTCG
CATTTCAACGCCAGACAGCAGCTTTCGGTATACGAAAGTCCCGCCCCGTTCCAACAGATCCATCACATACGGCTCAAAAATGTAGCCACACAGCGATTGC
GCGAGTGGGTTTCCATCACAGGAGCTGAGAAGGCATTGCATCTTTGCACGATCCAATCGGCACTTCGTTCGAGCAATCACTTGCATCGCCAATTCTGAAG
CATAGACAACACTATAATCTTGATATGGTTCTTCGCTGTGGATGTGGATCAATCTTTGGATAATCTTGGTCTTCGAGTTAATCTCGGAGTGGATGGAAAC
CAACATGATGCAATCATCCAGCGAACAACTGTTGCATGACGACGTCAACAAAGCATGCGGATCTGTTTGAATGTCTTGCAACACTAAACGAGGCACACCA
CCCAAGCAATCCAGACGATGC