Description :
From Genome Similarity Track
Location :
Scaffold_415:7882- 8947
Transcript NameFunction/comments
Phyta_totarag8086hypothetical protein PHYSODRAFT_323421

Sequence
1065 bases(100 bases per row)
GAGTTGCGCTGCAAAACCCACTCCACGGCGTTAGGGAAGCCCGTGGCGACGTGAGACGGCGGGGGATCTGAGTACATCAGCAACAGGCTTTTTATTGTAC
GTTTGTAGAGGAGGAGATCGCTTACAGCGCAAAAGCCGGTAGCAAAGATACCAAAACACGTACTGATCTTTGCCTCGTCGCCGCTCCTGTATTTACCTGT
CCGCACAAGTACGCCACGCATCCCCAGCTCTATGGCGCCGTGCACGTCTTGACGGAAGTCATCGCCGATCATGACTGCCTCCGCTGGAGCAATGTTCCTA
GGACACCCACGCCACATCAGTACCATTAACAACACACAAGTGGTAAACAGAAATCAcgcgctacatgtacagtactcaAGTCTTTGAGTGCTTGGCTGTA
GAATGTTGGTGCAGGCTTTCTACGAGCAGACATCGTTTCGTTACGGTGGTCGGGTAAGTGAAGCACACCATGAACCCCCGTCGAGTTTTTTACGCTTCGT
GTAGGGCGATCAACGAGCCTCCGTCAAGCAGCACGCGAAATGCCTCATTGAGCTATCCATCAACGAAAATCCTTTCTGTCAGCACAGCTTCACTGTCGAC
TGGAACCAAGGCATCGTACAACACCTTATCATAGTGGAAATGCTCCGGAGCAAgaccaacgacgacggcgttCGGGTTGGTGCGGTCGAGCCCGTTGAAC
TCTTCCTCAAGGGACGggtcgaccagcagcagcgggcgAAGGTTGCGTTGTTCAAGCAAACTACAGGCGATACCTCCTGACGTCAGAACATGTTCAGCGT
CAATGTTGTCGAGTCCGATgcggtgcagctgctggatctgtaAGTCACTCGTGCGTTGTTAGACCCTTCGTTCCGTTCACGGACATCCATCCACCAGTCA
AGTGACGCACCAATTCCCGCCGGGACTTGGTCGTCGTATTAGTCACTGCCGGGAACAGTACGGAAGAGCACAGTGACACGGTTTAGCTTCGTATCTGTTT
AGCTAAGTTCGACAGAGCGTTTTGAATTTCTCACACACCGAAGCGCACACTGATATCTGGAtgag