Description :
From Genome Similarity Track
Location :
scaffold_5:7881- 9431
Transcript NameFunction/comments
g8100.t1hypothetical protein

Sequence
1550 bases(100 bases per row)
TCGTTTGGACCAATCACTGAAGAGGAGTCGAATCTGCCCAATCAGGTACATGCCGACGCAGTACCGTGTCTTCGTAAAAGGAGGCAAAATGCCTCCTTTT
ACAAGAGCCCTACCGCAAAATGTAACTACAGGTGTCGTGTTGTCTGACTGCGTACTTAGCTGGAGAGCCCATCACCACCTCAAAAGGAGGCATTTTGCCT
CCTTCTACAAACCAGTATCTTAACTTTGTATAGTATAGTTAAGGTAGGTGGCTCATGAAAGGGTTAACCCCCCTACGCCCACACGTTGTATTTGACAACA
TGAATCATGTTGTACGTACAACATGTTTGAATAGGGGTTGGCTCGGAAAACGGCTAAGTATAGTGAACTCAAATTTAATCAAATGCTGACAAAGCCGAGA
CTTTCCCGCAAATGCACAGGGGTAGGCATAAACCGTTCATAAACGAAACTGGCATCGGTAGATGGCTGGTGTTCATTTGAAGAAAAATAAAAAGAACGCA
AGAAAGCAGGAGACGCATGGCGAGGAATAAGGCCCGGCGAGAATCCCGAGCTCAGCACCAGCGCGTTCTGGAACGTCTGGGTGGTCGTAACCCAGAGGAG
CGGCAGCATCTTGTGAAGGAACATGCTGCCTATTTGGCCGGAGAGCGCGACACCGACGTTGACTTCAGGGACGACAACCAGGCGCCATCAGCGGCTGAAG
AGCCGCGCACTGCCCCCCGCAAGACCTGGAAACCTCCGGCAAGACCTCCGACGGGTAAGGACGTTTCTTACCTTAGGGCCCAGAAGCGTCTAGTCTCCGA
GCAGCGCCGAGCTGTTGCCGCGAAGACGTCCGCTGGCTCTGGAAAGAAACTGGCTGTCACGAGAACTACCAAGGACGACGACAGCGACTTTAATCCCGAC
GAAGTAGATGATGATGACGACGAGGAAGTGGAGGAGATGGATGTCGACAGTGTTGAGAAGGAGACGGAATCGAGGGCGGCGAAAAGGAAGGCAAAGCCTG
TGGCATCGACGACAGCGAAGAAGAAGGCAAAAAGCAGCACCAACCCTCGAGGGAAAAGTGGTAAAGGTATGTCATGTTTGATGTTGTATGATACAGCAAG
TACTTACAACTAGCTCATACTGGATGAAATGCAGGTGCAGCAAAGCCTCGAAAGCCAAGTGCTGCCCGCGTGGCCAAGGAGAAGGAAGAGAAAAGGCAGC
AGCTAAGAGTCGGTGTGCAGCCACTGCAGCTGCCGAAGAAGCGGGTGCTGCAGCGCACGAGGATGCGAGAACAAAACTGGACAAGAATTCTCCAGCTGCG
AAGAGGCGTCAGAAGAACGTAAGTGTCGCGGTGGTGCCGAAATGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTTGTGCAACATGCACTAAGGGA
TACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACATCTTTCTACCAATGAGAGTCATTCAATAGA
TAGGGGTTCTGTCAGCCATCTAATGGCAGAACCTCTCATTAGAAATATCA